تاثیر فیزیولوژیک اتیلن و اسید سالیسیلیک بر بیان ژن های CTR1 و NPR1 دخیل در جوانه زنی و برخی از ویژگی‌های فیزیولوژیک بذر زوال یافته سویا

نوع مقاله : مقاله پژوهشی

نویسندگان

1 دانش آموخته دکترای تخصصی فیزیولوژی گیاهان زراعی، گروه زراعت و اصلاح نباتات، دانشکده کشاورزی دانشگاه تهران، کرج

2 استاد گروه زراعت و اصلاح نباتات دانشگاه فردوسی مشهد.

3 دانشیار، گروه زراعت و اصلاح نباتات، دانشکده کشاورزی دانشگاه تهران، کرج

4 دانشجوی دکترای تخصصی فیزیولوژی گیاهان زراعی دانشگاه فردوسی مشهد، مشهد

چکیده

سویا از مهم‌ترین گیاهان دانه روغنی است که از مشکلات تولید آن، کاهش قوه نامیه و بنیه بذر طی مدت نگه‌داری و پیش از کشت می‌باشد. به‌منظور تعیین اثر زوال بر بذر سویا و همچنین تعیین اثر اتیلن و اسید سالیسیلیک بر بهبود زوال بذر، پ بذرهای سویا به‌مدت صفر، شش و 10 روز در معرض پیری تسریع شده و شش ماه پیری طبیعی به‌مدت قرار گرفتند. بذرها پس از پیری با اسید سالیسیلیک با غلظت  50 میکرو مولار و ACC (پیش ماده اتیلن) با غلظت 10 میکرو مولار به‌مدت شش ساعت در دمای 25 درجه سلسیوس تیمار شدند. همچنین دسته‌ای از بذرها پس از آزمون پیری تسریع شده و طبیعی، بدون هیچ تیماری به‌عنوان شاهد (بذر خشک) استفاده شدند. درصد جوانه‌زنی، فعالیت آنزیم های کاتالاز، سوپراکسید دیسموتاز، گلوتاتیون پراکسیداز، پروتئین کل و مالون دی‌آلدهید مورد بررسی قرار گرفت. همچنین بیان ژن‌های CTR1 و NPR1 در بذرهای خشک و همچنین طی شش و 12 ساعت تحت اثر آب، اسید سالیسیلیک و ACC به روش Q-RT- PCR مورد بررسی قرار گرفت. با افزایش پیری، درصد جوانه زنی کاهش یافت و میزان مالون دی‌آلدهید افزایش و میزان پروتئین کل کاهش یافت. فعالیت آنزیم‌های کاتالاز، سوپراکسید دیسموتاز و گلوتاتیون پراکسیداز کاهش یافت. ژن‌ها بیان متفاوتی را در روزها و ساعت‌های  مختلف از خود نشان دادند. هورمون اسید سالیسیلیک و ACC اثرات متفاوتی را بر موارد اندازه‌گیری شده داشتند. در مجموع می‌توان گفت که پیری سبب اختلال در صفات فیزیولوژیکی بذر می‌شود و اسید سالیسیلیک و اتیلن نمی‌توانند سبب بهبود زوال بذر سویا شوند.

کلیدواژه‌ها


عنوان مقاله [English]

Physiological effects of ethylene and salicylic acid on germination improvement and CTR1 and NPR1 gene expression and some of the physiological features of the degraded seed of Glycine max (L.)

نویسندگان [English]

  • Mahboubeh Haji Abbasi 1
  • Reza Tavakol afshari 2
  • Alireza Abbasi 3
  • Reza Kamaei 4
1 Agronomy and Plant Breeding Department, Faculty of Agriculture, University of Tehran, Iran.
2 Department of Agronomy and Plant Breeding, Ferdowsi University of Mashhad, Mashhad. Iran
3 Agronomy and Plant Breeding Department, Faculty of Agriculture, University of Tehran, Iran.
4 Department of Agronomy, Ferdowsi University of Mashhad, Mashhad, Iran
چکیده [English]

Glycine max is one of the important oilseed plants in the world. One of the problems of G. max production is seed deterioration and low germination and vigor during seed storage and before planting time. To investigate the effects of deterioration on seed and the effects of salicylic acid and ethylene on the improvement of the deteriorated seed of G. max, an experiment was conducted accelerated aging test for 0, 6 and 10 days and a natural aging test for 6 months. After aging conditions, seeds were imbibed with 50 mM salicylic acid and 10 mM ACC (precursor of ethylene) for 6 hours at 25 °C. Also, some seed was used without any hormonal treatment as a control seed (called dry seed) after the natural and accelerated aging test. Germination percentage, the activity of catalase, superoxide dismutase and glutathione peroxidase enzyme, total protein, and malondialdehyde were measured. CTR1 and NPR1 Gene expressions were investigated on dry seed and under imbibitions of water, salicylic acid and ACC at 6, 12 hours with the Q-RT-PCR method. Seed germination decreased; malondialdehyde content increased and total protein decreased. Catalase, superoxide dismutase and glutathione peroxidase enzyme activities were decreased and electrical conductivity increased with the progress of aging. Gene expression varied at different days and different hours. Salicylic acid and ACC had different effects on measured traits. Totally, aging caused seed physiology disorder and salicylic acid and ACC were not able to improve deteriorated soybean seed.

کلیدواژه‌ها [English]

  • Catalase
  • CTR1
  • malondialdehyde
  • seed deterioration
  • NPR1

مقدمه

سویا با نام علمی Glycine max (L.) Merrill منبع اولیه روغن گیاهی است. مطالعات در زمینه علم تغذیه نشان می‌دهد که مصرف سویا، کلسترول سرم خون، سرطان و بیماری های قلبی را کاهش می‌دهد که خود می‌تواند زمینه‌ساز افزایش تقاضا برای تولید آن باشد (Lee et al., 2007). یکی از مشکلات کشت سویا، عدم دسترسی به بنیه بالا در زمان کشت می‌باشد زیرا بذرهای سویا معمولاً توانایی جوانه‌زنی‌اشان را در طول ذخیره‌سازی بلند مدت حتی در شریط مطلوب از دست می‌دهند (Haji Abbasi et al., 2020)

زوال بذر، تغییرات بیوشیمیایی و فیزیولوژیکی را در بر می‌گیرد که شامل تغییرات ژنتیکی، تغییر فعالیت‌های آنزیمی و آسیب‌های غشایی است؛ با این وجود، دلیل اصلی از دست دادن قوه نامیه روشن نیست (Sharma et al., 2005). فاکتورهای زیادی در زوال بذر موثر هستند که شامل عوامل ژنتیکی، آسیب مکانیکی، رطوبت نسبی، دمای محیط ذخیره‌سازی، محتوی رطوبت بذر، وجود میکروفلورا، رسیدگی بذر  و عوامل دیگر است که در صورت کاهش کیفیت بذر، شرایط را برای اهداف کشت نامناسب می‌کند (McDonald, 2004).

مکانیزم‌های مختلفی در فرایندهای پیری شرکت دارند که سبب کاهش بنیه و کیفیت بذر می‌شوند که به تغییر پروتئین‌ها، گونه‌های فعال اکسیژن (ROS)، تغییرات لیپیدها و تغییرات DNA اشاره کرد. کاهش در میزان کل پروتئین بذر، یکی از حوادثی است که در طول پیری بذر به وقوع می‌پیوندد. یکی از دلایل کاهش پروتئین بذر، خسارت به سیستم‌های سنتز کننده پروتئین است که در بذرهای غلات و درختان گزارش شده است. از دلایل دیگر می‌توان به سنتز و فعالیت بالای آنزیم‌های پروتئولیتیک در طول زوال بذر اشاره نمود. افزایش در فعالیت پروتئازها در طی دوره انبارداری از دیگر آسیب‌های زوال بذر می‌باشد. در محورهای جنینی بذر، تولید هورمون‌های گیاهی به تنظیم این پروتئازها کمک می‌کند. همچنین، میزان کل پروتئین در محورهای جنینی و لپه‌های بذرهای ریکال سیترنت در طول دورۀ انبارداری کاهش می‌یابد و اندازه‌گیری فعالیت پروتئازها در محور جنینی و لپه‌ها نشان داد که میزان آن‌ها در طول دورۀ انبارداری افزایش می‌یابد (Coolbear, 1995).

واکنش‌های شیمیایی پروتئین که منجر به از دست دادن زنده‌مانی بذر می‌شود، از طریق محصولات میلارد بررسی شده است. این واکنش به‌وسیله گلیکوزیله شدن، کاتالیز می‌شود که با پیوند قندهای احیا شده به گروه آمینی آمینواسید و پروتئین‌ها مرتبط می‌شود تا پروتئین های گلیکوزیله شده تشکیل شود که منجر به تخریبDNA  و رونویسی ناقص می‌شود و سنتز ناقص پروتئین در طول جوانه‌زنی بذر را در پی دارد (McDonald, 2004). رابطه واکنش میلارد برای از دست دادن زنده مانی بذر  بررسی شد و مشاهده شد که جوانه‌زنی همراه با تجمع محصولات میلارد در جنین‌های سویا کاهش می‌یابد (Wettlaufer & Leopold, 1991).

گیاهان به‌عنوان ارگانیسم‌های هوازی به اکسیژن برای تولید انرژی نیاز دارند. یک نتیجه زندگی هوازی، تشکیل ROS است و در واقع احیای نسبی اکسیژن مولکولی، منجر به ایجاد  ROSمی‌شود. در طول احیای اکسیژن به آب، ROSها مثل رادیکال سوپراکسید، پراکسید هیدروژن و رادیکال هیدروکسیل می‌توانند تشکیل شوند (Vranova et al., 2002). ROS به‌عنوان عامل آسیب به لیپید، پروتئین و اسیدنوکلئیک در نظر گرفته می‌شوند؛ همچنین به‌عنوان مولکول‌های سیگنالی تنظیم‌کننده‌های رشد و نمو، مرگ برنامه‌ریزی شده سلول، سیگنالینگ پاسخ به تنش‌های زنده و غیر زنده و سیگنالینگ هورمون‌ها محسوب می‌شوند (Bailly et al., 2008).

نقش مخرب ROS ها در بذرها، به‌علت تمایل بالایی که به مولکول‌های زیستی مثل پروتئین‌ها، قندها، لیپیدها و اسیدهای نوکلئیک دارند می‌باشد. انتقال نقش سیگنالی به نقش مخرب، به‌علت تجمع ROS در بالای سطح آستانه است که منجر به تغییرات سلولی و آسیب‌های سلولی می‌شود. دو فرآیند فیزیولوژی که در بذر اتفاق می‌افتد و به نظر می‌رسد که به شدت به نقش مخرب ROS مرتبط شود، پسابیدگی و پیری بذر می‌باشند (Bailly et al., 2008).

وجود یک سیستم کمپلکس آنتی‌اکسیدانت در بذرها به اثبات رسیده است. وظیفه این سیستم، حفظ سلول‌ها در برابر آسیب ROSها می‌باشد. توانایی بذر برای مقابله با تنش ممکن است به توانایی آن‌ها برای زدودن ROS به‌منظور جلوگیری از پراکسیداسیون اجزای مهم سلول مرتبط می‌شود. گیاهان، سیستم‌های آنتی‌اکسیدانتی برای حفاظت از غشاهای سلولی و ارگانل‌ها از آسیب‌های ROS دارند که شامل مکانیزیم‌های حفاظتی آنزیم‌ها، ویتامین‌ها و متابولیت‌ها می‌باشند و هر یک به روش خاص می‌توانند سلول‌ها را در برابر حمله رادیکال‌های آزاد حفظ نمایند. از جمله آنزیم‌های سم‌زدای پراکسیدها می‌توان به سوپراکسید دیسموتاز، کاتالاز و آنزیم‌های چرخه گلوتاتیون اشاره کرد که با پراکسیدهیدروژن واکنش می‌دهند و فعالیت ROS را خنثی می‌کند (Bailly, 2004).

جوانه‌زنی و سبز شدن، یکی از مهم‌ترین مراحل رشدی گیاه است که تعیین‌کننده درجه موفقیت سیستم‌های زراعی در تولید می‌باشد (Forcella et al., 2000). قدرت جوانه‌زنی بذر، بسته به دما و رطوبت در دوران رسیدگی، برداشت و انبارداری نامناسب کاهش پیدا می‌کند و دچار زوال یا فرسودگی می‌شود (Marshal & Lewis, 2004). به‌طور معمول در بذرهای زوال یافته جوانه‌زنی، سبز شدن بذر و رشد گیاهچه کاهش می‌یابد (McDonald, 1999).

فرسودگی بذر موجب تخریب DNA می‌شود و این امر منجر به اختلال در فرآیند نسخه‌برداری و در نهایت عدم سنتز آنزیم‌های ضروری (آمیلازها و آنتی اکسیدان‌ها) مورد نیاز برای مراحل اولیه جوانه‌زنی بذر می‌شود. بدون فعالیت آنزیمی مناسب، ذخایر بذر هیدرولیز نمی‌شود و در نتیجه مولکول های لازم برای سنتز حامل های انرژی نظیر ATP قابل دسترس نخواهد بود (McDonald, 1999).

CTR1 (Constitutive triple response 1) یک پروتئین است که به خانواده RAF از پروتئین کیناز Ser/Thr تعلق دارد و تنظیم‌کننده پاسخ اتیلنی است. CTR1 در حضور اتیلن، غیر فعال است و غیر فعال بودن آن، منجر به فعالیت EIN2 که یک تنظیم‌کننده مثبت پاسخ اتیلنی است می‌شود و در نتیجه، ارسال سیگنال درک اتیلن به هسته انجام می‌شود و با روشن شدن ژن‌های دخیل در پاسخ اتیلن، این پاسخ ها آغاز می‌شوند (Beyer, 1976). به نظر می‌رسد که فعالیت کینازی CTR1 مربوط به ناحیه C ترمینال پروتئین است که با سرین/ترئونین پروتئین کینازهای خانواده پروتئینی RAF تشابه دارد (Kieber et al., 1993). مشابه نقشی که RAF کینازها در پستانداران دارد، CTR1 احتمالاً یک MAP کیناز ((MAPKKK است و مهار سیگنال اتیلن احتمالاً از طریق یک آبشار MAPKK و MAPK پیچیده صورت می‌گیرد (et al., 2000 Novika). شواهد اخیر نشان داده است که تیمار با پیش ماده اتیلن ((ACC منجر به تحریک آبشار MAPK در آرابیدوپسیس و فعال شدن  CTR1 می‌شود (Ouaked et al., 2003).

گیاهان یک سیستم امنیتی بسیار قوی دارند  و در مواجهه با هر نوع تنشی، گروهی از پروتئین‌ها تحت عنوان پروتئین‌های مرتبط با بیمارگر ( (PRرا تولید می‌نمایند. پروتئین‌های PR گروه متنوعی از پروتئین‌های گیاهی هستند که موجب تخریب دیواره‌های سلول قارچی، ایجاد اختلال در غشاهای سلولی آن، تقویت سیستم پاسخ دفاعی اختلال در غشاهای سلولی آن، تقویت سیستم پاسخ دفاعی قارچی می‌شوند (Van Loon et al., 2006). نسخه بیان نشده ژن‌های مرتبط با بیماری‌زاییNon-expresser of PathogensisRelated genes 1( (NPR1) ، به‌عنوان واسطه کلیدی در مقاومت القایی شناخته شده است (Tada et al., 2008). پروتئین NPR1 تحت شرایط نرمال، به‌صورت الیگومریک و غیرفعال در سیتوزول سلول وجود دارد، اما به محض آلودگی گیاه به بیمارگر، وضعیت اکسایشی سلول تغییر می‌کند و پروتئین NPR1 به‌وسیله شکستن پیوندهای دی سَولفید خود، به فرم مونومری تبدیل می‌شود (Mou et al., 2003) که می‌تواند به‌وسیله کنش با نوع خاصی از فاکتورهای تنظیم کننده رونویسی ((TGA، بیان ژن‌های دفاعی PR را القاء کند (Mou et al., 2003؛ Johnson et al., 2003). NPR1 همچنین به‌وسیله تنظیم سیگنال های پایین دست سالسیلیک اسید ((SA بر مسیر SAR تاثیر می‌گذارد (Durrant & Dong, 2004 ؛Dong, 2004)، به‌طوری‌که موتانت‌های npr1 آرابیدوپسیس، فاقد توانایی القای ژن‌های PR و افزایش   SARحتی پس از تیمار با  SA می‌باشند. درحالی‌که انتقال ژن NPR1 به این نوع گیاهان موتانت، نه تنها سبب رفع شدن تاثیر جهش می‌شود، بلکه پاسخ به عوامل تحریک کننده SAR را با بیان بالای ژن PR، به حالت اول بر گردانده و مقاومت به آلودگی Pseudomonas syringae را در پی دارد (Clarke et al., 2004).

از طرفی، رشد و نمو گیاهان از مراحل ابتدایی تا مراحل پیشرفته چرخه زندگی، به‌وسیله فیتوهورمون‌های مختلف تنظیم می‌شود. یکی از این فیتوهورمون‌ها اتیلن است؛ اتیلن یک هیدروکربن گازی دارای ساختار شیمیایی CH2-CH2 می‌باشد و در جنین‌زایی زیگوتی بذر، جوانه‌زنی، گلدهی، رسیدگی، پیری و پاسخ به پاتوژن‌ها دخالت دارد (Matilla, 2000). به نظر می‌رسد که اتیلن در فرآیند جوانه‌زنی بذرهای معینی دخالت دارد و خروج ریشه‌چه را تحت شرایط نامطلوب (برای مثال در دمای بالا) افزایش می‌دهد. در بذرهای کاهو، دمای رسیدگی بر جوانه‌زنی بذر اثر می‌گذارد که خود به‌وسیله اثر بر تولید اتیلن می‌باشد (Kozarewa et al., 2006). درمطالعات اخیر نشان داده شده است که کاربرد اتیلن، جوانه‌زنی را به‌وسیله کاهش حساسیت به اسید آبسیزیک، افزایش می‌دهد (Beaudoin, 2000).

همچنین سالیسیلیک‌اسید، یک ترکیب فنولیک است که سطوح پایه آن در میان گونه‌ها متفاوت است؛ سطوح اختلاف می‌تواند حتی در میان اعضای یک گونه مشاهده شود. اسید سالیسیلیک در بیان ژن‌های مرتبط با پاتوژن‌ها(PR)[1]، مقاومت اکتسابی سیستمیک و پاسخ‌های فوق حساسیت و همچنین در پاسخ به تنش‌های غیر زنده مثل ازون، شوری، اشعه فرابنفش، خشکی، گرما، سرما، پاراکوات و تنش فلزات سنگین دخالت دارد. در انتقال نموی تاثیر پذیرفته به‌وسیله تنش مثل گلدهی، القای غده و پیری دخیل است (Rivas-San Vicente & Javier Plasencia, 2011).

هدف از این آزمایش،  تاثیر فیزیولوژیک اتیلن و اسید سالیسیلیک بر بیان برخی ژن های دخیل در جوانه‌زنی و برخی از ویژگی‌های فیزیولوژیک بذر زوال یافته سویا بود.

 

مواد و روش‌ها

این آزمایش به‌صورت فاکتوریل و در قالب طرح کامل تصادفی با چهار تکرار در دانشکده کشاورزی و منابع طبیعی پردیس کرج در سال 93-1392 اجرا شد. در این تحقیق، از بذر سویا Gرقم  Bauyanaاستفاده شد که از موسسه بین‌المللی CSIRO واقع در شهر کانبرای استرالیا تهیه شد. عوامل آزمایشی شامل زوال بذر در چهار سطح (پیری تسریع شده صفر، شش، 10 روز و پیری طبیعی) و هورمون‌های مختلف شامل اسید سالیسیلیک و پیش ماده اتیلن بود. بذرها در معرض پیری تسریع شده به‌مدت صفر، شش و ده روز (در دمای 40 درجه سلسیوس و رطوبت نسبی 100%) و پیری طبیعی (نگهداری شده در دمای 25 درجه سلسیوس به‌مدت شش ماه) قرار گرفتند. بذرها پس از پیری با اسید سالیسیلیک با غلظت 50  میکرو مولار و ACC (پیش ماده اتیلن) با غلظت 10 میکرو مولار به‌مدت شش ساعت در دمای 25 درجه سلسیوس تیمار شدند. همچنین دسته‌ای از بذرها پس از آزمون پیری تسریع‌شده و طبیعی و بدون هیچ تیماری، به‌عنوان شاهد (بذر خشک) استفاده شدند. در صد جوانه‌زنی، هدایت الکتریکی و همچنین بیان ژن‌های CTR1 وNPR1  در بذرهای خشک و طی شش و دوازده ساعت تحت اثر آب، اسید سالیسیلیک و ACC به روش Q-RT- PCR مورد بررسی قرار گرفت.

برای انجام آزمون پیری زودرس، 250 عدد بذر به‌صورت یک لایه بر روی صفحات مشبک درورن جعبه‌های مخصوص آزمون پیری زودرس قرار داده شدند. به میزان یک سوم حجم جعبه‌ها، ظرف آب به دقت اضافه شد، به‌طوری‌که از پاشیدن آب بر روی بذرها خودداری شد. سپس جعبه ها در دمای 40 درجه سلسیوس به‌مدت تعیین شده در هر تیمار قرار گرفتند. پس از پایان این زمان در هر تیمار، درصد رطوبت نمونه‌های بذری باید در محدوده 27 تا 30% باشد، در غیر این صورت، آزمون باید دوباره تکرار شود (Hampton & Tekrony, 2005). در پایان، آزمون جوانه‌زنی استاندارد و هدایت الکتریکی برای بذرهای انجام گرفت.

تنها به‌منظور اطمینان از درستی آزمون پیری زودرس، رطوبت و درصد رطوبت بذر تعیین شدشد. بدین منظور، پنج گرم بذر در دمای 103 درجه سلسیوس به‌مدت 17 ساعت قرار داده شد و در نهایت درصد رطوبت بر اساس وزن تر تعیین با استفاده از رابطه (1) تعیین شد.

رابطه (1)               (W2 –W1)/(W2 –W3)= محتوی رطوبت (%)

در این رابطه، W1: وزن ظرف خالی، W2: وزن ظرف به همراه وزن نمونه بذر قبل از خشک شدن و W3: وزن ظرف به همراه وزن نمونه خشک است (ISTA, 2009). دوباره بر این نکته تاکید می‌شود که این آزمون تنها جهت اطمینان از درستی کار انجام گرفت و تمام نمونه‌های بذری پس از آزمون پیری زودرس، رطوبتشان به 28% رسیده بود.

طبق قوانین انجمن بین المللی آزمون بذر، آزمون جوانه‌زنی استاندارد با روش بین کاغذ[2] در دمای 5/0± 25 درجه سلسیوس در تاریکی به‌مدت شش روز انجام گرفت.

اندازه‌گیری مالون دی‌آلدهید به روش (Stewart & Bewley, 1980) انجام گرفت. اساس آزمون بر واکنش مالون دی‌آلدهید تولید شده با تیوباربیوتیک اسید (TBA)[3] استوار است که منجر به تشکیل کمپلکس رنگیMDA-TBA  می‌شود که می‌توان غلظت آن را با کمک دستگاه اسپکتروفتومتر اندازه گیری کرد و واحد اندازه‌گیری آن میکرومول بر گرم وزن نمونه بود.

استخراج پروتئین کل بر اساس روش (Bradford, 1976) با اعمال تغییرات جزئی و در طول موج 595 نانومتر صورت گرفت. فعالیت آنزیم کاتالاز در دمای 1±25 درجه سلسیوس به روش (Clairbone, 1985) و در طول موج 240 نانومتر اندازه‌گیری شد. همچنین، فعالیت آنزیم گلوتاتیون پراکسیداز در دمای 1±25 درجه سلسیوس به روش (Polle et al., 1994) اندازه‌گیری شد. دستگاه اسپکتروفتومتر روی طول موج 470 نانومتر تنظیم شد. از طرفی، اندازه‌گیری سوپراکسید دیسموتاز طبق روش (Giannopolitis & Ries., 1977) انجام گرفت و فعالیت آنزیم به‌صورت فتوترومیک بررسی شد. دستگاه اسپکتوفتومتر در طول موج 560 نانومتر کالیبره شد.

استخراج RNA بر اساس روش (Chang et al., 1993) انجام شد. همچنین برای ساخت cDNA، دو میکروگرم RNA درون تیوب ریخته شد و به آن یک میکرو لیتر Oligo DT mM پنج و دو میکرو لیتر dNTP  mMپنج اضافه شد و به حجم 13 میکرولیتر رسانده شد. سپس تیوب ها پنج دقیقه در دمای 65 درجه سلسیوس و یک دقیقه بر روی یخ قرار گرفتند و برای پنج ثانیه سانتریفیوژ شدند و به آن‌ها چهار میکرولیتر بافرFSB[4]، یک میکرولیتر از هر یک از[5] DTT   mM1/0 ، mM RNase out یک و SSIII [6]  mM یک اضافه شد. سپس تحت دمای 50 درجه سلسیوس برای 60 دقیقه و 70 درجه سلسیوس برای 15 دقیقه قرار گرفتند. پس از آن 5/0 میکرو لیتر RNaseH به تیوب‌ها اضافه شد و 30 دقیقه در دمای 37  درجه سلسیوس قرار داده شدند و در نهایت به تیوب‌ها   [7]MQ H2O اضافه شد تا به حجم 100 میکرولیتر برسند. در این مرحله، ساخت cDNA کامل شد. برای انجام Q-RT PCR ابتدا cDNA آماده شده در مرحله قبل به نسبت یک به 10 رقیق شد. سپس برای انجام Q-RT PCR از 10 میکرولیتر مستر Q-RT-PCR (شرکت اینویتروژن)[8] و 10 میکرولیتر از cDNA رقیق شده و یک میکرولیتر پرایمر استفاده شد. پرایمرها  که با نرمافزار Primer 3 و Oligo analyzer طراحی شدند،  در جدول (1) آمده‌اند. برای انجام  Q-RT PCRاز دستگاه روتور ژن کیو (کوایژن)[9] استفاده شد.

مراحل  Q-RT PCR مشتمل بود بر چهار دقیقه در دمای 94 در درجه سلسیوس، آن‌گاه 50  دور چرخه تکرار شامل 10 ثانیه در دمای 95 درجه سلسیوس ، 15 ثانیه در دمای 60 درجه سلسیوس و 20 ثانیه در دمای 72 درجه سلسیوس، سپس به‌نبال هر دور،  برنامه منحنی ذوب (از 72 درجه سلسیوس تا 95 درجه سلسیوس با پنج ثانیه درنگ در هر دما) صورت می‌گرفت که ثبت نتایج فلوروسنس در مرحله 72 درجه سلسیوس طی برنامه منحنی ذوب انجام می‌گرفت. سطوح بیان ژن‌های مورد نظر متناسب با بیان ژن UKN2 (Hypothetical protein) (به‌عنوان ژن مرجع) به روش آنالیز کمی مقایسه‌ای با استفاده از نرم افزارRotor-Gene-Q Series  صورت گرفت. به‌منظور کنترل نتایج و حصول اطمینان از این که نتایج به‌واسطه تشکیل دیمر آغازگر رقم نخورده است، از تیمار کنترل که در آن به جای نمونه از آب استفاده می‌شد، بهره گرفته شد. نتایج ارائه شده، میانگین سه نمونه (سه تکرار) است و از اشتباه استاندارد برای مقایسه تفاوت‌ها استفاده شده است.

تجزیه‌های آماری بر اساس مدل آماری طرح‌های مورد استفاده توسط نرم‌افزار SAS 9.1 انجام شد. مقایسه میانگین‌های هر صفت با استفاده از آزمون چند دامنه‌ای دانکن در سطح پنج درصد انجام گرفت و رسم شکل و نمودارها با بهره‌گیری از نرم‌افزار Excel انجام شد.

نتایج و بحث

آزمون جوانه‌زنی

نتایج جوانه‌زنی نشان داد که با افزایش تعداد روزهای پیری، جوانه‌زنی کاهش یافت (شکل 1). بذرهای خشک غیر پیر که هیچ گونه تیماری بر آن ها صورت نگرفته بود، 95% جوانه‌زنی داشتند. بعد از شش روز پیری، جوانه‌زنی به 5/92% بود که تفاوت معنی‌داری با بذرهای غیر پیر (صفر روز پیری) نداشت و بعد از 10 روز، جوانه‌زنی به صفر رسید (شکل b1). جوانه‌زنی بذرهای غیر پیر تیمار شده با ACC به % رسید که تفاوت معنی‌داری با بذرهای غیر پیر خشک نداشت. همچنین جوانه‌زنی بذرهای غیر پیر تیمار شده با اسیدسالیسیلیک، 5/87 % بود که تفاوت معنی‌دار با بذرهای غیر پیر خشک نداشت.  ACCو اسیدسالیسیلیک نتوانستند جوانه‌زنی بذرهای 10 روز پیر را از صفر درصد تغییر دهند (شکل a1).

بذرهای پیر طبیعی (نگه‌داری شده به‌مدت شش ماه در دمای 25 درجه سلسیوس) 5/57 % جوانه‌زنی داشتند. استفاده از اسید‌سالیسیلیک و ACC v,d بذرهای پیر طبیعیT جوانه‌زنی را به‌ترتیب به 5/62 و 65 % رساند که تفاوت معنی‌داری با یکدیگر نداشتند (شکل a1). مطابق با نتایج تحقیق حاضر، مطالعات نشان می‌دهد، همچنان که تغییرات کاتابولیک با افزایش سن ادامه می‌یابد، توانایی بذر برای جوانه‌زدن کاهش می‌یابد. کاهش در زنده‌مانی یا ظرفیت جوانه‌زنی بلافاصله بعد از رسیدگی شروع نمی‌شود و تحت شرایط مطلوب ذخیره‌سازی، شروع کاهش در جوانه‌زنی ممکن است چندین ماه تا چندین سال بسته به شرایط ذخیره‌سازی و شرایط در طول نمو بذر شروع شود (Shelar et al., 2008). بذرهای سویا به‌طورکلی زندگی کوتاه‌تری در مقایسه با سایر گونه‌‌ها دارد. بذرهای سویا که برای 11 ماه در دمای اتاق نگه‌داری شده بودند، جوانه‌زنی اندکی را نشان دادند (Shelar et al., 2008).

 

 

جدول 1- پرایمرهای فورواد و ریورس

Table 1. Forwards and rovers Primers

Reverse primer

Forwad primer

ژن

TTCCATCATCGCAGTGTGTTC

ATTCAACCATTCCCCCTGATACT

CTR1

CTCCACATACCTTCTTCGCTTCC

ACGCTTCTTCCCTCGATGCT

NPR1

 

a

b

   

شکل 1- a: جوانه‌زنی بذرها با سطوح مختلف پیری بدون استفاده و با استفاده از هورمون در بذر سویا، b: جوانه‌زنی بذرها تحت پیری تسریع شده در زمان‌های مختلف (صفر، شش و 10 روز)، تحت تأثیر هورمون‌های مختلف.  ACC: آمینوسیکلوپروپان-1- کربوکسیلیک اسید. SA: اسید سالیسیلیک. D: تعداد روزهای پیری تسریع شده در دمای 40 درجه سلسیوس و رطوبت نسبی 100 درصد. NA: پیری طبیعی به‌مدت شش ماه در دمای 25 درجه سلسیوس.

Figure 1. a: Seed germination in different aging levels using various hormones in soybean seed, b: Seed germination under accelerated aging in different times (0, 6 and 10 days) affected by various hormones.  ACC: Amino-cyclopropane-1-carboxylic acid, SA: salicylic acid, D: Accelerated aging days at 40 °C and relative humidity of 100%, NA: Natural aging for six months at 25 °C.

 

 

مالون دی‌آلدهید (MDA)

با افزایش سطوح پیری از صفر به 10 روز، سطوح MDA افزایش یافت (شکل a2). پراکسیداسیون لیپیدها، یکی از نتایج پاسخ سریع به تنش‌هاست. محتوی MDA به‌عنوان یک شاخص پراکسیداسیون لیپید در نتیجه تنش اکسیداتیو در نظر گرفته می‌شود (Malenčić et al., 2004). افزایش محتوی MDA در پاسخ به پیری تسریع‌شده و با افزایش مدت زمان از صفر به 10 روز پیری، نشان‌دهنده این است که پراکسیداسیون لیپیدها اتفاق افتاده است که با نتایج افزایش هدایت الکتریکی در طول 10 روز پیری و کاهش جوانه‌زنی مطابقت دارد. مشابه با نتایج ما، مطالعات  نشان می‌دهد که در طول پیری، تجمع ROS ها و پراکسیداسیون لیپیدها، تغییراتی را در خصوصیات ساختاری و عملکردی لیپیدهای غشا به‌وجود می‌آورند که سبب افزایش نفوذپذیری غشا می‌شوند. آسیب به غشا، منجر به نشت الکترولیت‌ها می‌شود که هدایت الکتریکی بذر را افزایش می‌دهد و به از دست دادن قوه نامیه منجر می‌شود (Mira et al., 2011). پراکسیداسیون لیپیدها به‌عنوان دلیل اصلی مرگ بذر در طول پیری پیشنهاد شده است (McDonald, 1999)، اما مکانیزم‌های متفاوتی در تخریب بذر دخالت دارند که با محتوی رطوبت بذر متغییرند. گزارش شده است که لیپیدها به‌وسیله پراکسیدازها به کتون‌ها، آلدهیدها و الکل ها شکسته می‌شوند. پراکسیداسیون لیپیدها و محصولات ثانویه آن‌ها می‌توانند با گروه آمینواسیدها در پروتئین ها واکنش دهند و منجر به تخریب آن‌ها شوند. محتوی محصولات پراکسیداسیون لیپدها می‌تواند با معرف TBA-TCA تخمین زده شود. محصولات واکنش TBA حد و گستره پراکسیداسیون لیپدها را در محورهای جنینی نشان داد و گزارش شد که همبستگی بالایی با محصولات آمادوری و میلارد دارند و شاخصی از هیدرولیز قندها و پراکسیداسیون لیپیدها هستند که می‌تواند سبب از دست دادن قوه نامیه و بنیه بذر شود (Castilho et al., 1994). افزودن ACC در بذر غیر پیر و شش روز، سبب افزایش MDA شد، ولی در بذر 10 روز پیر، تفاوتی مشاهده نشد (شکل a2). این نتایج با نتایج افزایش MDA در گیاهچه‌‌های چاودار هماهنگی دارد. گزارش شده است که در گیاهچه‌های چاودار، تیمار با اتیلن سبب افزایش MDA می‌شود (Ievinsh, 1992). همچنین افزودن اسیدسالیسیلیک به بذرهای غیر پیر و شش روز، تفاوتی در میزان MDA ایجاد نکرد. در بذرهای پیر طبیعی، محتوی MDA نسبت به بذرهای غیر پیر افزایش داشت که نشان‌دهنده فرآیندهای اکسیداسیون لیپیدهاست، ولی در بذر پیر طبیعی، افزودن ACC و اسیدسالیسیلیک اثر معنی‌داری بر میزان MDA نداشت (شکل b2). گزارش شده است که بذرهای پیر شده طبیعی سویا، روند کندتری در کاهش لیپدها نسبت به بذرهای آزمون پیری زودرس دارند (Coolbear, 1995).

 

 

 

a

b

   

شکل 2- a: مالون دی‌آلدهید بذرهای تحت پیری تسریع شده در زمان‌های مختلف (صفر، شش و 10 روز) تحت تأثیر هورمون‌های مختلف.  ACC: آمینوسیکلوپروپان-1- کربوکسیلیک‌اسید. SA: اسیدسالیسیلیک. D: تعداد روزهای پیری تسریع شده در دمای 40 درجه سلسیوس و رطوبت نسبی 100 درصد. NA: پیری طبیعی به‌مدت شش ماه در دمای 25 درجه سلسیوس. b: مالون دی آلدهید بذرهای با سطوح مختلف پیری بدون استفاده و با استفاده از هورمون در بذر سویا.

Figure 2. a: MDA under accelerated aging in different times (0, 6 and 10 days) affected by various hormones.  ACC: Amino-cyclopropane-1-carboxylic acid, SA: salicylic acid, D: Accelerated aging days at 40 °C and relative humidity of 100%, NA: Natural aging for six months at 25 °C. b: MDA in different aging levels using various hormones in soybean seed

 

 

پروتئین

با تغییر سطوح پیری از صفر روز به 10 روز، میزان غلظت پروتئین کل کاهش یافت (شکل a3). همچنین میزان پروتئین کل در بذرهای پیر طبیعی نسبت به بذرهای غیر پیر کاهش یافت (شکل b3)، اما استفاده از اسیدسالیسیلیک و ACC تغییری در میزان پروتئین در هر سطح پیری تسریع‌شده و همچنین پیری طبیعی ایجاد نکرد (شکل a3، b3). از دلایل کاهش پروتئین می‌‌توان به اختلال در سیستم سنتز پروتئین در بذرهای زوال یافته اشاره کرد (Coolbear, 1995). همچنین از نتایج واکنش‌های آمادوری و میلارد، پیوند قندها به گروه آمینی آمینواسیدها و اختلال در سنتز پروتئین‌ها یا تشکیل پروتئین‌های ناقص است. همچنین تخریب DNA یکی از نتایج زوال است که خود می‌تواند عامل مهمی در اختلال در سنتز پروتئین‌ها باشد (McDonald, 1999). از دیگر دلایل کاهش پروتئین‌ها، افزایش فعالیت آنزیم‌های کاتابولیک نظیر افزایش فعالیت پروتئازها می‌باشد (Coolbear, 1995). در هر دو پیری طبیعی و مصنوعی مشاهده شده است که کربونیله شدن پروتئین‌ها به شدت افزایش می‌یابد و پروتئین‌های مورد هدف کربونیله شدن مشابه است. همچنین اکسیداسیون پروتئین‌ها یک فرآیند تصادفی نیست و پروتئین‌های خاصی مورد هدف قرار می‌گیرند. به‌علاوه فرآیند ترجمه در مسیر سنتز پروتئین در هر دو پیری طبیعی و مصنوعی به شدت بازداری می‌شود (Job et al., 2005).

 

 

a

b

   

شکل 3- a: غلظت پروتئین بذرهای تحت پیری تسریع شده در زمان‌های مختلف (صفر، شش و 10 روز) تحت تأثیر هورمون‌های مختلف.  ACC: آمینوسیکلوپروپان-1- کربوکسیلیک اسید. SA: اسید سالیسیلیک. D: تعداد روزهای پیری تسریع شده در دمای 40 درجه سلسیوس و رطوبت نسبی 100 درصد. NA: پیری طبیعی به‌مدت شش ماه در دمای 25 درجه سلسیوس. b: مالون دی‌آلدهید بذرهای با سطوح مختلف پیری بدون استفاده و با استفاده از هورمون در بذر سویا.

Figure 3. a: Protein concentration under accelerated aging in different times (0, 6 and 10 days) and affected by various hormones.  ACC: Amino-cyclopropane-1-carboxylic acid, SA: salicylic acid, D: Accelerated aging days at 40 °C and relative humidity of 100%, NA: Natural aging for six months at 25 °C. b: Protein concentration in different aging levels using various hormones in soybean seed

 

 

فعالیت آنزیم‌های آنتی‌اکسیدانت

فعالیت آنزیم کاتالاز در بذر خشک از صفر روز به شش روز پیری (شکل a4). و نیز در بذرهای پیر طبیعی نسبت به بذرهای غیر پیر کاهش یافت (شکل b4). افزودن ACC و اسیدسالیسیلیک، سبب افزایش فعالیت کاتالاز در بذر غیر پیر و بذر شش روز پیر و همچنین در بذر پیر طبیعی شد (شکل a4 و شکل b4)،  ولی همچنان فعالیت کاتالاز با افزایش سطوح پیری کاهش یافت (شکل a4) که نشان‌دهنده اهمیت کاتالاز در طول پیری است. گزارش شده است که بازداری کاتالاز به‌وسیله آمینوتترازول در طول تیمار پرایمینگ بذرهای زوال یافته آفتابگردان، ترمیم بذر را کاهش داد که بیان کننده این است که کاتالاز نقش مهمی در حفاظت و سیستم‌های ترمیم در طول پیری دارد (Kibinza et al., 2011). افزودن ACC و اسیدسالیسیلیک به بذر 10 روز پیر، سبب تغییر فعالیت کاتالاز نشد (شکل a4). مشابه نتایج این تحقیق، در بذرهای سالم سویا مشاهده شد که فعالیت کاتالاز در اثر پیری تسریع‌شده کاهش می‌یابد. کاتالاز یک آنزیم کارا در کاتابولیزه کردن پراکسید هیدروژن در محور جنینی است. وقتی بذرهای سویا در 42 درجه سلسیوس و رطوبت نسبی 100% ذخیره شدند، بذرها تحت تنش قرار گرفتند و جوانه‌زنی خود را تحت یک رفتار وابسته به زمان از دست دادند. القای کاتالاز در بذرها با قوه نامیه پایین اتفاق نیفتاد و منجر به افزایش قابل توجه در میزان پراکسید هیدروژن شد (McDonald, 2004). نتایج تحقیق حاضر مطابق نتایجی است که نشان می‌دهد کاتالاز و آسکوربات پراکسیداز نقش مهمی را در سویا در جلوگیری از استرس اکسیداتیو به‌وسیله کاتالیز کردن احیای پراکسیدهیدروژن بازی می‌کنند (Kibinza et al., 2011). گزارش شده  است که در میوه‌های کلیماتریک، پیک تولید اتیلن با پیک فعالیت کاتالاز و سوپراکسید دیسموتاز و رسیدگی میوه منطبق است (Masia, 1998) که نشان‌دهنده تاثیر اتیلن بر فعالیت کاتالاز و سوپراکسید دیسموتاز و ارتباط آن با پیری می‌باشد.

با افزایش سطوح پیری، فعالیت سوپراکسید دیسموتاز (شکل c4) و نیز  فعالیت سوپراکسید دیسموتاز در بذرهای پیرشده طبیعی نسبت به بذرهای غیر پیرکاهش یافت (شکل d4). فعالیت سوپراکسید دیسموتاز با افزودن ACC و اسیدسالیسیلیک در بذر غیر پیر و شش روز پیر افزایش یافت، ولی در بذر 10 روز پیر تغییری ایجاد نشد (شکل c4). در بذرهای پیر شده طبیعی نیز فعالیت سوپراکسید دیسموتاز با افزودن ACC و اسیدسالیسیلیک، بیشتر از بذر پیر طبیعی خشک بود (شکل d4). در تایید نتایج تحقیق حاضر، مشاهده شده است که تنش‌هایی مثل آلودگی میکروبی، تیمار با اتیلن و اسید سالیسیلیک در Nicotiania  plumbaginifolia تجمع رونوشت سوپراکسید دیسموتاز را القا کرده است (Bowler et al., 1989) که نشان‌دهنده نقش دفاعی سوپراکسید دیسموتاز در رویارویی با شرایط تنش و همچنین نقش اتیلن و اسید سالیسیلیک در القای فعالیت سوپراکسید دیسموتازاست (Bowler et al., 1989). هم راستا با نتایج این تحقیق نشان داده شده است که توانایی جوانه‌زنی بذر ممکن با کارایی زدودن رادیکال‌های آزاد مرتبط باشد، زیرا رادیکال‌های آزاد ممکن است بر توانایی ذخیره‌سازی و بنیه تاثیر بگذارند. اثر پیری تسریع شده بر توانایی جوانه‌زنی و خصوصیات فیزیولوژیک مرتبط با پراکسیداسیون در دو رقم سویا بررسی شد. نتایج نشان داد که پیری تسریع‌شده، جوانه‌زنی بذر، رشد گیاهچه وفعالیت سوپراکسید دیسموتاز و آسکوربات پراکسیداز را باز می‌دارد (McDonald, 2004).

با افزایش سطوح پیری، فعالیت گلوتاتیون پراکسیداز کاهش پیدا کرد (شکل e4). با افزودن ACC و اسیدسالیسیلیک در بذر خشک غیر پیر، شش و 10 روز پیر، تفاوتی در فعالیت گلوتاتیون پراکسیداز مشاهده نشد (شکل e4). فعالیت گلوتاتیون در بذرهای پیر طبیعی نسبت به بذرهای غیر پیر کاهش یافت (شکل f4) و با افزودن ACC و اسیدسالیسیلیک به بذر پیر طبیعی، تفاوت معنی‌داری در فعالیت گلوتاتیون پراکسیداز در مقایسه با بذر پیر طبیعی خشک مشاهده نشد (شکل f4). مشابه با نتایج تحقیق حاضر، مشاهده شد که در بذرهای آفتابگردانی که به‌مدت طولانی ذخیره شده‌اند، فعالیت گلوتاتیون پراکسیداز بسیار پایین بوده است. همچنین در این بذرها، قوه نامیه، گلوتاتیون (به فرم احیا شده) و فعالیت گلوتاتیون ردوکتاز نیز پایین بود که بیان‌کننده این است که در طول پیری، آسیب اکسیداتیو اتفاق افتاده است (Paula et al., 1996). همچنین گزارش شده است که در طول پیری تسریع‌شده بذرهای آفتابگردان، پراکسیداسیون لیپیدها، سبب خسارت به سیستم‌های از بین برنده رادیکال‌های آزاد می‌شود و کاهش در فعالیت کاتالاز و گلوتاتیون ردوکتاز اتفاق می‌افتد. این نتایج نشان می‌دهد که توانایی جوانه‌زنی ممکن است به سیستم‌های دفاعی آنتی‌اکسیدانتی که نقش مهمی را در توانایی ذخیره‌سازی و بنیه بازی می‌کنند، مرتبط شود. بررسی درباره تغییرات آنزیمی در طول ذخیره‌سازی نشان داد که فعالیت گلوتاتیون ردوکتاز ، کاتالاز و آسکوربات پراکسیداز کاهش می‌یابد که با بنیه بذر همبستگی دارد. با این وجود، فعالیت سوپراکسید دیسموتاز تغییر باقی ماند (Narayana et al., 2002). در آزمون پیری تسریع‌شده، کم‌ترین فعالیت آنزیم‌های آنتی‌اکسیدانت در بذرهای 10 روز پیر اتفاق افتاد و در  این بذرها، جوانه‌زنی صفر درصد بود. روند کاهشی فعالیت آنزیم‌های آنتی‌اکسیدانت در طول پیری تسریع‌شده مشاهد شد که این شواهد، بیانگر این است که آنزیم‌های‌ آنتی‌اکسیدانت، نقش مهمی در طول پیری و جوانه‌زنی دارند. مطالعات حاکی از این است که اسیدسالیسیلیک، ظرفیت اکسیداتیو را در گیاه بهبود می‌بخشد و سبب کاهش تنش اکسیداتیو در گیاهان می‌شود و در سازگاری گیاه به تنش کمک می‌کند (Rivas-San Vicente & Javier Plasencia., 2011).  نتایج تحقیق حاضر نشان داد که استفاده از اسیدسالیسلیک می‌تواند سبب افزایش فعالیت سیستم آنتی‌اکسیدانتی بذر غیر بذر پیر، شش روز پیر و بذرهای پیر شده طبیعی به واسطه افزایش فعالیت کاتالاز، سوپراکسید دیسموتاز شود. در جو مشاهده شد که استفاده از اسیدسالیسیلیک، سبب پاسخ‌های پیش سازگاری به تنش شوری می‌شود، منجر به واکنش‌های حفاظتی پیگمانت‌های فتوسنتزی می‌شود و سبب نگه‌داری یکنواختی غشا می‌شود و سبب بهبود رشد گیاه می‌شود (El Tayeb, 2005).

 

 

 

b

a

   

d

c

   

f

e

   

شکل 4- a: فعالیت کاتالاز، c: فعالیت سوپراکسید دیسموتاز و e: گلوتاتیون پراکسیداز بذرهای تحت پیری تسریع‌شده در زمان‌های مختلف (صفر، شش و 10 روز) تحت تأثیر هورمون‌های مختلف.  ACC: آمینوسیکلوپروپان-1- کربوکسیلیک اسید. SA: اسید سالیسیلیک. D: تعداد روزهای پیری تسریع‌شده در دمای 40 درجه سلسیوس و رطوبت نسبی 100 درصد. NA: پیری طبیعی به‌مدت شش ماه در دمای 25 درجه سلسیوس. b: فعالیت کاتالاز، d: سوپراکسید دیسموتاز و f: گلوتاتیون پراکسیداز بذرهای با سطوح مختلف پیری بدون استفاده و با استفاده از هورمون در بذر سویا.

Figure 1. a: CAT, c: SOD and e: GPX under accelerated aging in different times (0, 6 and 10 days) and affected by various hormones.  ACC: Amino-cyclopropane-1-carboxylic acid, SA: salicylic acid, D: Accelerated aging days at 40 °C and relative humidity of 100%, NA: Natural aging for six months at 25 °C. b: CAT, d: SOD and f: GPX in different aging levels using various hormones in soybean seed

 

 

بیان ژن NPR1[10]

با افزایش سطوح پیری از صفر روز به 10 روز، بیان NPR1 افزایش یافت (شکل a5). افزایش بیان NPR1 در اثرآب نوشی در بذر صفر و شش روز پیر در شش ساعت در مقایسه با بذر خشک غیر پیر مشاهده شد (شکل b5، c5). در اثر استفاده از ACC در بذرهای شش روز پیر، بیان NPR1 در شش و 12 ساعت روند افزایشی را داشت (شکل f5).

 

 

b

a

   

d

c

   

f

e

   

شکل 5- بیان ژن NPR1 a: تحت تأثیر سطوح مختلف (صفر، شش و 10 روز) ا پیری تسریع شده در بذرهای خشک، b: تحت تأثیر تیمار زمان­های مختلف آب نوشی (بذر خشک، شش و 12 ساعت آب نوشی) در بذرهای غیر پیر، c: تحت تأثیر اعمال شش روز پیری تسریع شده و تیمار زمان­های مختلف آب نوشی (بذر خشک، شش و 12 ساعت آب نوشی)، d: تحت تأثیر اعمال 10روز پیری تسریع شده و تیمار زمان­های مختلف آب نوشی (بذر خشک، شش و 12 ساعت آب نوشی)، e: تحت تأثیر تیمار زمان­های مختلف اعمال هورمون ACC (بذر خشک، شش و 12 ساعت) در بذرهای غیر پیر، f: تحت تأثیر اعمال شش روز پیری تسریع شده و تیمار زمان­های مختلف اعمال هورمون ACC (بذر خشک، شش و 12 ساعت) در بذر سویا. Days: تعداد روزهای اعمال پیری تسریع شده در دمای 40 درجه سلسیوس و رطوبت نسبی 100 درصد.  h: تعداد ساعت تحت تاثیر تیمار هورمون و یا آب. و ACC : آمینوسیکلوپروپان-1- کربوکسیلیک اسید.

Figure 5. NPR1 gene a: affected by different aging levels in dry seeds, b: affected by different inhibition times treatments (dry seed, 6 and 10 h inhibition) in non-aging seeds, c: affected by 6 days aging and different inhibition times treatments (dry seed, 6 and 10 h inhibition), d: affected by 10 days aging and different inhibition times treatments (dry seed, 6 and 10 h inhibition), e: affected by ACC application in different times (dry seed, 6 and 10 h ACC application) in non-aging seeds, f: affected by 6 days aging and ACC application in different times (dry seed, 6 and 10 h ACC application). Days: accelerated aging days number at 40 °C and relative humidity of 100%, h: The number of hours affected by hormone or water treatment, ACC: Amino-cyclopropane-1-carboxylic acid

 

 

در اثر استفاده از اسیدسالیسیلیک، بیان NPR1 در 12 ساعت در بذرهای شش روز پیرافزایش یافت (شکل c6) که با یافته‌های افزایش  بیان NPR1 در آرابیدوپسیس در اثر استفاده از اسیدسالیسیلیک مطابقت داشت. ژن NPR1 یک ژن حیاتی در پاسخ به تنش‌هاست که به‌وسیله اسیدسالیسیلیک القا می‌شود. در واقع پروتئین NPR1 یکی از اجزای کلیدی مسیر سیگنالی اسیدسالیسیلیک است.

 

 

b

a

   

d

c

   

f

e

   

شکل 6- بیان ژن NPR1، a: تحت تأثیر اعمال 10روز پیری تسریع شده و تیمار زمان­های مختلف اعمال هورمون ACC (بذر خشک، شش و 12 ساعت)، b: تحت تأثیر تیمار زمان­های مختلف اعمال هورمون SA (بذر خشک، شش و 12 ساعت) در بذرهای غیر پیر، c: تحت تأثیر اعمال شش روز پیری تسریع شده و تیمار زمان­های مختلف اعمال هورمون SA (بذر خشک، شش و 12 ساعت)، d: تحت تأثیر اعمال 10روز پیری تسریع شده و تیمار زمان­های مختلف اعمال هورمون SA (بذر خشک، شش و 12 ساعت)، e: تحت تأثیر بذر غیر پیر و اعمال پیری طبیعی و تیمار زمان­های مختلف آب نوشی (بذر خشک، شش و 12 ساعت آب نوشی)، f: تحت تأثیر بذر غیر پیر و اعمال پیری طبیعی و تیمار زمان­های مختلف اعمال هورمون SA (بذر خشک، شش و 12 ساعت) در بذر سویا. ACC: آمینوسیکلوپروپان-1- کربوکسیلیک اسید. SA: اسید سالیسیلیک. Days: تعداد روزهای اعمال پیری تسریع شده در دمای 40 درجه سلسیوس و رطوبت نسبی 100 درصد. h: تعداد ساعت تحت تاثیر تیمار هورمون و یا آب. NA: پیری طبیعی به‌مدت شش ماه در دمای 25 درجه سلسیوس.

Figure 6. NPR1 gene expression, a: affected by 10 days aging and ACC application in different times (dry seed, 6 and 10 h ACC application), b: affected by SA application in different times (dry seed, 6 and 10 h ACC application) in non-aging seeds, c: affected by 6 days aging and SA application in different times (dry seed, 6 and 10 h ACC application), d: affected by 10 days aging and SA application in different times (dry seed, 6 and 10 h ACC application), e: affected by non-aging seed and natural aging and different inhibition times treatments (dry seed, 6 and 10 h inhibition), f: affected by non-aging seed and natural aging and SA application in different times (dry seed, 6 and 10 h ACC application) in soybean seed. ACC: Amino-cyclopropane-1-carboxylic acid, SA: salicylic acid, Days: accelerated aging days number at 40 °C and relative humidity of 100%, h: The number of hours affected by hormone or water treatment, NA: Natural aging for six months at 25 °C.

 

این فاکتور هسته‌ای، زمانی که فعال شود یک پاسخ ایمنی را ایجاد می‌کند که منجر به مقاومت اکتسابی سیستماتیک[11] می‌شود. بیا NPR1 ممکن است که با بیان ژن‌های مسیرگلدهی و یا با بیان ژن‌های گلدهی که با تنش القا می‌شوند، همراه باشد (McGivern et al., 2013). بذرهای شش روز پیر تحت تاثیر آب، جوانه‌زنی بالایی داشتند، اما هدایت الکتریکی نیز بالا بود که نشان می‌دهد بذرها زوال پیدا کرده بودند که ممکن است جوانه‌زنی بالای آن‌ها به دلیل مقاومتی که باشد کهNPR1 ایجاد کرده باشد.

NPR1 به‌وسیله مکانیزم حساس به رداکس تنظیم می‌شود. اسیدسالیسیلیک سبب مونومریزه شدن NPR1 می‌شود و سبب می‌شود که از سیتوسل به هسته انتقال یابد و در هسته با دیگر فاکتورها واکنش دهد و بیان ژن‌های دفاعی را فعال کند و بنابراین سبب مقاومت به عامل تنش می‌شود (Rivas-San Vicente & Javier Plasencia., 2011). بیان NPR1 در اثر پیری طبیعی نسبت به بذرهای غیر پیر افزایش یافت (شکل e6). از آن‌جای که پیری با افزایش رادیکال‌های آزاد همراه است، افزایش بیان NPR1 در اثر پیری منطقی به نظر می‌رسد.

افزایش بیان NPR1تحت اثر ACC در بذرهای شش روز پیر، احتمالاً به دلیل نقش اتیلن در پاسخ های دفاعی است (شکل f5). مشاهده شده است که اتیلن، بیانPR1[12] وابسته به‌وسیله اسید سالیسیلیک را تقویت می‌کند. بیان ژن NPR1 برای فعال‌سازی مقاومت  اکتسابی القایی و پاسخ‌های دفاعی وابسته به اسید سالیسیلیک مورد نیاز است (Nandi et al., 2003). در بذرهای پیر شده طبیعی، بیان NPR1 در اثر استفاده از اسید سالیسیلیک، ACC و آب در مقایسه با بذر خشک کاهش یافته بود که گویای این مطلب است که پیری طبیعی و مصنوعی متفاوت از یکدیگر عمل کرده‌اند.

بیان ژن CTR1[13]

با افزایش سطوح پیری از صفر روز به 10 روز، بیان CTR1 افزایش یافت (شکل a8). بیان CTR1 در بذرهای غیر پیر و شش روز پیر تحت تاثیر آب در شش ساعت، افزایش و در 12 ساعت کاهش یافت، اما همچنان بیان آن نسبت به بذر خشک غیر پیر و شش روز پیر بالاتر بود (شکل b8، c8). مطالعات نشان داده است که CTR1 با گیرنده‌های اتیلن مانندETR1[14]  ،  ETR2 و EIN4[15] واکنش متقابل دارد و دریافت اتیلن را تنظیم می‌کند و CTR1 به‌عنوان یک تنظیم‌کننده منفی مسیر سیگنالی اتیلن عمل می‌کند (Corbineau et al., 2014). در تحقیق حاضر، یک افزایش و به دنبال آن کاهش بیان CTR1 با جوانه‌زنی 95% در بذرهای غیر پیر مطابقت داشت.

افزودن ACC به بذرهای غیر پیر، سبب افزایش بیان CTR1 شد (شکل e8). در بذرهای غیر پیر که تحت تاثیر شرایط نامطلوب نبودند و نیازی به اتیلن نبود، افزایش بیان CTR1صورت گرفت که در واقع CTR1 از ادامه مسیر سیگنالی اتیلن جلوگیری کرده است. مطالعات نشان داده است که افزایش بیان CTR1از ادامه مسیر سیگنالی اتیلن جلوگیری می‌کند (Corbineau et al., 2014).

افزودن ACC به بذرهای 10 روز پیر، با کاهش بیان CTR1 همراه بود (شکل a9). مطالعات نشان می‌دهد که CTR1 در حضور اتیلن غیرفعال می‌شود و اجازه فعال شدن فاکتورهای پاسخ دهنده به اتیلن را می‌دهد (Corbineau et al., 2014). هر چند که این کاهش بازدارندگی CTR1 نتوانست جوانه‌زنی صفر درصد را افزایش دهد که احتمالاَ به دلیل شدت آسیب وارده به بذرهای 10 روز پیر بوده است.

در بذرهای پیر طبیعی خشک نسبت به بذر غیر پیرخشک، افزایش بیان CTR1 مشاهده شد که با کاهش جوانه‌زنی بذرهای پیر طبیعی خشک (5/57%) مطابقت داشت. افزودن ACC به بذرهای پیر طبیعی، سبب کاهش CTR1 در 12 ساعت شد (شکل f9) که در این راستا مشاهده شده است که اتیلن می‌تواند با کاهش اثر بازدارندگی CTR1، گیرنده‌های اتیلن مثل EIN2 را فعال کند. EIN2 یک تنظیم‌کننده مثبت سیگنالینگ اتیلن است که سبب فعال شدن فاکتورهای رونویسی می‌شود (Corbineau et al., 2014). با این حال، الگوی بیان متفاوتی از CTR1-like در طول نمو و رسیدگی میوه های کلیماتریک مشاهده شده است. برای نمونه در میان چهار ژن CTR1-like در گوجه فرنگی، بیان LeCTR1 در پاسخ به اتیلن افزایش می‌یابد، درحالی‌که LeCTR3 و LeCTR4 غیرحساس به اتیلن هستند که در سطوح بالاتر در برگ نسبت به میوه تجمع می‌یابند و در تمام طول رسیدگی میوه، پایین باقی می‌مانند (Adams-Phillips et al., 2004).

 

 

 

 

شکل 7- بیان NPR1 در سطوح مختلف پیری بدون استفاده و با استفاده از هورمون. SA: اسید سالیسیلیک، h: تعداد ساعت تحت تاثیر تیمار هورمون و یا آب. NA: پیری طبیعی به‌مدت شش ماه در دمای 25 درجه سلسیوس.

Figure 7. NPR1 gene expression at different aging levels with and without hormones. SA: salicylic acid, h: The number of hours affected by hormone or water treatment, NA: natural aging for six months at 25°C.

 

 

در میوه‌های کیوی، بیان دو ژن CTR1-like الگوی متفاوتی با یکدیگر دارند. AdCTR1  در مرحله کلیماتریک افزایش می‌یابد، درحالی‌که AdCTR2 تغییرات چندانی ندارد (Yin et al., 2008). اسیدسالیسیلیک در بذرهای غیر پیر، سبب افزایش بیان CTR1 (شکل b9) و همچنین بیان CTR1 در بذرهای شش روز پیر شد (شکل c9) که با کاهش جوانه‌زنی بذرهای شش روز پیر مطابقت داشت. اما در بذرهای 10 روز پیر، سبب کاهش CTR1 شد (شکل d9) که نشان می‌دهد CTR1 غیر از مسیر سیگنالینگ اتیلن، در مسیر هورمون اسیدسالیسیلیک نیز موثر است.

 

نتیجه‌گیری‌کلی

با توجه به نتایج این پژوهش در مجموع می‌توان چنین استنباط کرد که زوال بذر و کاهش بنیه، نتیجه برآیند فرآیندهای تخریبی متعدد و اختلال در فعالیت های فیزیولوژیکی بذر است. این پژوهش نشان داد که پیری با افزایش در میزان مالون دی‌آلدهید و کاهش پروتئین همراه است و بذر با تغییر در فعالیت آنزیم‌های آنتی‌اکسیدانت، سعی در متعادل کردن شرایط ایجاد شده دارد. همچنین بیان ژن‌های دخیل در مسیر جوانه‌زنی نیز دستخوش تغییر می‌شوند. افزایش بیان ژن‌های  CTR1 (به‌عنوان یک تنظیم کننده منفی مسیر سیگنالی اتیلن) و NPR1 در هر دو مسیر پیری تسریع‌شده و پیری طبیعی مشاهده شد. برآیند تمام این تغییرات، کاهش بنیه و جوانه‌زنی بود. هنگامی که اسید سالیسیلیک و ACC روی بذرهای غیر پیر استفاده شدند، خود همانند عامل تنش‌زا عمل کردند، ولی هنگامی که روی  بذرهای پیر شده طبیعی و مصنوعی اعمال شدند، تنها در برخی موارد اندازه‌گیری شده، اثر مثبت داشتند. در مجموع این دو هورمون نتوانستد سبب ترمیم بذر زوال یافته سویا شوند.

 

b

a

   

d

c

   

f

e

   

شکل 8- بیان ژن ،CTR1 a: تحت تأثیر سطوح مختلف (صفر، شش و 10 روز) ا پیری تسریع شده در بذرهای خشک، b: تحت تأثیر تیمار زمان­های مختلف آب نوشی (بذر خشک، شش و 12 ساعت آب نوشی) در بذرهای غیر پیر، c: تحت تأثیر اعمال شش روز پیری تسریع شده و تیمار زمان­های مختلف آب نوشی (بذر خشک، شش و 12 ساعت آب نوشی)، d: تحت تأثیر اعمال 10روز پیری تسریع شده و تیمار زمان­های مختلف آب نوشی (بذر خشک، شش و 12 ساعت آب نوشی)، e: تحت تأثیر تیمار زمان­های مختلف اعمال هورمون ACC (بذر خشک، شش و 12 ساعت) در بذرهای غیر پیر، f: تحت تأثیر اعمال شش روز پیری تسریع شده و تیمار زمان­های مختلف اعمال هورمون ACC (بذر خشک، شش و 12 ساعت) در بذر سویا. Days: تعداد روزهای اعمال پیری تسریع شده در دمای 40 درجه سلسیوس و رطوبت نسبی 100 درصد.  h: تعداد ساعت تحت تاثیر تیمار هورمون و یا آب و ACC : آمینوسیکلوپروپان-1- کربوکسیلیک اسید.

Figure 8. CTR1 gene, a: affected by different aging levels in dry seeds, b: affected by different inhibition times treatments (dry seed, 6 and 10 h inhibition) in non-aging seeds, c: affected by 6 days aging and different inhibition times treatments (dry seed, 6 and 10 h inhibition), d: affected by 10 days aging and different inhibition times treatments (dry seed, 6 and 10 h inhibition), e: affected by ACC application in different times (dry seed, 6 and 10 h ACC application) in non-aging seeds, f: affected by 6 days aging and ACC application in different times (dry seed, 6 and 10 h ACC application). Days: accelerated aging days number at 40 °C and relative humidity of 100%, h: The number of hours affected by hormone or water treatment, ACC: Amino-cyclopropane-1-carboxylic acid.

b

a

   

d

c

   

f

e

   

 

شکل 9- بیان ژن CTR1، a: تحت تأثیر اعمال 10روز پیری تسریع شده و تیمار زمان­های مختلف اعمال هورمون ACC (بذر خشک، شش و 12 ساعت)، b: تحت تأثیر تیمار زمان­های مختلف اعمال هورمون SA (بذر خشک، شش و 12 ساعت) در بذرهای غیر پیر، c: تحت تأثیر اعمال شش روز پیری تسریع شده و تیمار زمان­های مختلف اعمال هورمون SA (بذر خشک، شش و 12 ساعت)، d: تحت تأثیر اعمال 10روز پیری تسریع شده و تیمار زمان­های مختلف اعمال هورمون SA (بذر خشک، شش و 12 ساعت)، e: تحت تأثیر بذر غیر پیر و اعمال پیری طبیعی و تیمار زمان­های مختلف آب نوشی (بذر خشک، شش و 12 ساعت آب نوشی)، f: تحت تأثیر بذر غیر پیر و اعمال پیری طبیعی و تیمار زمان­های مختلف اعمال هورمون SA (بذر خشک، شش و 12 ساعت) در بذر سویا. ACC: آمینوسیکلوپروپان-1- کربوکسیلیک اسید. SA: اسید سالیسیلیک. Days: تعداد روزهای اعمال پیری تسریع شده در دمای 40 درجه سلسیوس و رطوبت نسبی 100 درصد. h: تعداد ساعت تحت تاثیر تیمار هورمون و یا آب. NA: پیری طبیعی به‌مدت شش ماه در دمای 25 درجه سلسیوس.

Figure 9. CTR1 gene expression, a: affected by 10 days aging and ACC application in different times (dry seed, 6 and 10 h ACC application), b: affected by SA application in different times (dry seed, 6 and 10 h ACC application) in non-aging seeds, c: affected by 6 days aging and SA application in different times (dry seed, 6 and 10 h ACC application), d: affected by 10 days aging and SA application in different times (dry seed, 6 and 10 h ACC application), e: affected by non-aging seed and natural aging and different inhibition times treatments (dry seed, 6 and 10 h inhibition), f: affected by non-aging seed and natural aging and SA application in different times (dry seed, 6 and 10 h ACC application) in soybean seed. ACC: Amino-cyclopropane-1-carboxylic acid, SA: salicylic acid, Days: accelerated aging days number at 40 °C and relative humidity of 100%, h: The number of hours affected by hormone or water treatment, NA: Natural aging for six months at 25 °C.

 

شکل 10- بیان NPR1 در سطوح مختلف پیری، بدون استفاده و با استفاده از هورمون. SA: اسید سالیسیلیک، h: تعداد ساعت تحت تاثیر تیمار هورمون و یا آب، NA: پیری طبیعی به‌مدت شش ماه در دمای 25 درجه سلسیوس.

Figure 10. CTR1 gene expression at different aging levels with and without using hormones. SA: salicylic acid, h: number of hours affected by hormone or water treatment, NA: natural aging for six months at 25°C.

 

REFERENCES

  1. Adams-Phillips, L., Barry, C., Kannan, P., Leclercq, J., Bouzayen, M. & Giovannoni, J. (2004). Evidence that CTR1-mediated ethylene signal transduction in tomato is encoded by a multigene family whose members display distinct regulatory features. Plant Molecular Biology, 54(3),387–404.
  2. Bailly, C. (2004). Active oxygen species and antioxidants in seed biology. Seed Science Research, 14, 93–107.
  3. Bailly, C., El-Maarouf-Bouteau, H. & Corbineau, F. (2008). From intracellular signaling networks to cell death: the dual role of reactive oxygen species in seed physiology. Comptes Rendus Biologies, 331, 806–814.
  4. Beaudoin, N., Serizet, C., Gosti, F. & Giraudat, J. (2000). Interactions between bscisic acid and ethylene signaling cascades. Plant Cell, 12, 1103–
  5. Beyer, E. M. (1976). Effect of Silver Ion, Carbon Dioxide, and Oxygen on Ethylene Action and Metabolism. Plant Physiology, 63, 169-173.
  6. Bowler, C., Alliotte, T., Loose, M. D., Montagu, M. V. & Inze, D. (1989). The induction of manganese superoxide dismutase in response to stress in Nicotiana plumbaginifolia. The EMBO Journal, 8, 31 – 38.
  7. Bradford, M. M. (1976). A dye binding assay for protein. Annals of Biochemistr, 72, 248-254.
  8. Castilho, R. F., Meinicke, A. R., Almeida, A. M., Hermes-Lima, M. & Vercesi, A.E. (1994). Oxidative damage of mitochondria induced by Fe (II) citrate is potentiated by Ca+2 and includes lipid peroxidation and alteration in membrane proteins. Archives of Biochemistry and Biophysics, 308, 158-163.
  9. Chang, S., Puryear, J. & Cairney, K. (1993). A simple and efficient method for isolating RNA from pine trees. Plant Molecular Biology Reporter, 11, 113-116.
  10. Clairbone, A. (1985). Catalase activity - Handbook of Methods for Oxygen Radical Research. (pp, 283-284.) Boca Raton, CRC Press..
  11. Clarke, S. M., Mur, L. A., Wood, J. E. & Scott, M. (2004). Salicylic acid dependent signaling promotes basal thermo tolerance but is not essential for acquired thermo tolerance in Arabidopsis thaliana. Plant Journal, 38, 432-447.
  12. Coolbear, P.. (1995). Mechanisms of seed deterioration, Seed quality: basic mechanisms and agricultural implications, Food Products Press, 223-277.
  13. Corbineau, F., Xia, Q., Bailly, C. & El-Maarouf-Bouteau, H. (2014). Ethylene, a key factor in the regulation of seed dormancy. Frontiers in Plant Science, 5, 1-13.
  14. Dong, X. (2004). NPR1, all things considered. Current Opinion in Plant Biology, 7, 547-552.
  15. El Tayeb, M. A. (2005). Response of barley grains to the interactive effect of salinity and salicylic acid. Plant Growth Regulation, 45, 215-224.
  16. Forcella, F., Benech Arnold, R. L., Sanchez, R. & Ghersa, C. M. (2000). Modeling seedling emergence. Field Crop Research, 67(2), 123-139.
  17. Giannopolitis, C. N. & S. K. (1977). Superoxide dismutases, I, Occurrence in higher plants. Plant Physiology, 59, 309-314.
  18. Haji Abbasi, M., Tavakkol Afshari, R Abbasi, A. R & Kamaei, R. (2020). The effect of ACC and salicylic acid on germination and GAI1 and LOX2 genes expression in deteriorated soybean seeds (Glycine max). Iranian Journal of Seed Research, 6(2), 61-79.
  19. Hampton, J. G. & Tekrony, D. M. (2005). Handbook of vigour test methods (3rd ed). The International Seed Testing Association, 70-72.
  20. Ievinsh. G. (1992). Soluble lipoxygenase activity in rye seedlings as related to endogenous and exogenous ethylene and wounding. Plant Science, 82, 155-159.
  21. International Seed Testing Association. (2009). International Rules for Seed Zurichtstr.50. CH 8303, Bassersdorf, Switzerland.
  22. Job, C., Rajjou, L., Lovigny, Y., Belghazi, M. & Job, D. (2005). Patterns of protein oxidation in Arabidopsis seeds and during germination. Plant Physiology, 138, 790–802.
  23. Johnson, C., Boden. E. & J. (2003). Salicylic acid and NPR1 induce the recruitment of trans-activating TGA factors to adefense gene promoter in Arabidopsis. Plant Cell, 15,1846–58.
  24. Kibinza, S., Bazin, J., Bailly, C., Farrant, J. M., Corbineau, F. & El-Maarouf-Bouteau, H. (2011). Catalase is a key enzyme in seed recovery from ageing during priming. Plant Science,181, 309–315.
  25. Kieber, J. J., Rothenburg, M., Roman, G., Feldmann, K. A. & Ecker, J. R. (1993). CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the raf family of protein Cell, 72, 427-441.
  26. Kozarewa, I., Cantliffe, D. J., Nagata, R. T. & Stoffella, P. J. (2006). High maturation temperature of lettuce seeds during development increased ethylene production and germination at elevated temperatures. American Horticulture Science, 131, 564–570.
  27. Lee, G. J., Wu, X., Shannon, J. G., Sleper, D. A. & Nguyen, H. T. (2007). Genome mapping and molecular breeding in plants. In Oilseeds, Volume II, ed. Kole, C. Springer-Verlag Berlin Heidelberg, 21-53.
  28. Malenčić, D. J., Vasić, D., Popović, M. & Dević, D. (2004). Antioxidant systems in sunflower as affected by oxalic acid. Biologia Plantarum, 48, 243-247.
  29. Marshal, A. H., & Lewis, D. N. (2004). Influence of seed storage conditions on seedling emergence, seedling growth and dry matter production of temperature forage grasses. Seed Science and Technology, 32(2), 493-501.
  30. Masia, A. (1998). Superoxide dismutase and catalase activities in apple fruit during ripening and post-harvest and with special reference to ethylene. Physiologia Plantrum, 104, 668-672.
  31. Matilla, A. J. (2000). Ethylene in seed formation and germination. Seed Science Research, 10, 111-126.
  32. Mc Donald, M. B. 1999. Seed deterioration: physiology, repair and assessment. Seed Science and Technology, 27(1), 177-237.
  33. McDonald, M. B. (2004). Orthodox seed deterioration and its repair. In Handbook of seed physiology applications to agriculture. Food Products Press. Volume II, ed. Benech, R.L. and Sanchez, R.A. (Food Products Press, 2004), pp.273-304.
  34. McGivern, J. J., Ganger, M. T., & Ewing, S. J. (2013). FT and NPR1 expression patterns in Arabidopsis thaliana during flowering and in response to salicylate. Preliminary Report BIOS, 84(4), 241-249.
  35. Mira, S., Estrelles, E., Gonzalez-Benito, M. E. & Corbineau, F. (2011). Biochemical changes induced in seeds of Brassicaceae wild species during ageing Acta Physiologiae Plantarum, 33, 1803–1809.
  36. Mou, Z., Fan, W. & Dong, X. (2003). Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell, 113, 935–944.
  37. Nandi, A., Kachroo, P., Fukushige, H., Hildebrand, D. F., Klessig, D. F. & Shah, J. (2003). Ethylene and jasmonic acid signaling affect the NPR1-Independent expression of defense genes without impacting resistance to Pseudomonas syringae and Peronospora parasitica in the Arabidopsis ssi1 Molecular Plant-Microbe Interactions, 16. 588–599.
  38. Narayana Murthy, U. M., Prakash, P. K. & Wendell, Q. S. (2002). Mechanisms of seed aging under different storage conditions for vigna radiate (L.) Wilczek: lipid peroxidation, sugar hydrolysis, maillard reactions and their relationship to lass state transition. Journal of Experimental Botany, 54 (348), 1057-1067.
  39. Novika, G. V., Moshkov, I. E., Smith, A. R. & Hall M. A. (2000). The effect of ethylene on MAPkinase-like activity in Arabidopsis thaliana. FEBS Lett, 474(1), 29-32.
  40. Ouaked, F., Rozhon, W., Lecourteux, D. & Hirt, H. (2003). A MAPK pathway mediates ethylene signaling in plants. EMBO Journal, 22(6), 1282-1288.
  41. Paula, M. D., Perez-Otaola, M., Darder, M., Torres, M., Frutos, G., & Martinez-Honduvilla, C. J. (1996). Function of ascorbate-glutathione cycle in aged sunflower seeds. Physiologia Plantarum, 96, 543-550.
  42. Polle, A., Otter, T. & Seifert, F. (1994). Apoplastic peroxidases and lignification in needles of Norway spruce (Picea abies). Plant Physiology, 106, 53–60.
  43. Rivas-San Vicente, M. & Javier Plasencia, J. (2011). Salicylic acid beyond defense: Its role in plant growth and development. Journal of Experimental Botany, 62(10), 3321–3338.
  44. Sharma, S., Virdi. P., Gambhir, S. & Munshi, S. K. (2005). Changes in soluble sugar content and antioxidant enzymes in soybean seeds stored under different storage conditions. Agricultral Biochemistry, 18, 9–12.
  45. Shelar, V. R., Shaikh, R. S. & Nikam, A. S. (2008). Soybean seed quality during storage: A review. Agricultural Reviews, 29(2), 125-131.
  46. Stewart, R. R. C. & Bewley, D. J. (1980). Lipid peroxidation associated with accelerated aging of soybean axes. Plant Physiology, 65, 245-248.
  47. Tada, Y., Spoel, S. H., Pajerowska Muhktar Mou, K. Z. & Song, J. (2008). Plant immunity requires conformational changes of NPR1 via S-nitrosylation and thioredoxins. Science, 321, 952–56.
  48. Van Loon, L.C., Rep, M. & Pieterse, C. M. J. (2006). Significance of Inducible Defense-related proteins in infected plants. Phytopathology, 44, 135-162.
  49. Vranova, E., Inze, D. & Breusegem, V. (2002). Signal transduction oxidative stress. Journal of Exprimental Botany, 53(372), 1227-1236.
  50. Wettlaufer, S. & Leopold, A. C. (1991). Relevance of amadori and maillard products to seed deterioration. Plant Physiology, 97, 165-1 69.
  51. Yin, X., Chen, K., Allan, A. C., Wu, R. M., Zhang, B., Lallu, N. & Fergu­son, I. B. (2008). Ethylene-induced modulation of genes associated with the ethylene signaling pathway in ripening kiwifruit. Journal of Experimental Botany, 59 (8), 2097–2108.

 

[1] - Pathogen-Related gene

[2] - Between paper  

[3] - Thio Barbituric Acid (TBA)

[4] - 5x First Strand Buffer

[5] - Dithiothreitol (DTT)

[6] - Super Script III Riverse transcriptase

[7] - Mill Q H2O

[8] - Invitrogen

[9] - Rotor Gene Q (QIAGEN)  

 

[10] - Non expressor of pathogenesis related genes (NPR1)

[11] - systemic acquired resistance (SAR)

[12] - Pathogenesis related gene (1)

[13] - Constitutive triple response 1 (CTR1)

[14] - Ethylene resistant 1 (ETR1)

[15] - Ethylene insensitive 4 (EIN4)

  1. REFERENCES

    1. Adams-Phillips, L., Barry, C., Kannan, P., Leclercq, J., Bouzayen, M. & Giovannoni, J. (2004). Evidence that CTR1-mediated ethylene signal transduction in tomato is encoded by a multigene family whose members display distinct regulatory features. Plant Molecular Biology, 54(3),387–404.
    2. Bailly, C. (2004). Active oxygen species and antioxidants in seed biology. Seed Science Research, 14, 93–107.
    3. Bailly, C., El-Maarouf-Bouteau, H. & Corbineau, F. (2008). From intracellular signaling networks to cell death: the dual role of reactive oxygen species in seed physiology. Comptes Rendus Biologies, 331, 806–814.
    4. Beaudoin, N., Serizet, C., Gosti, F. & Giraudat, J. (2000). Interactions between bscisic acid and ethylene signaling cascades. Plant Cell, 12, 1103–
    5. Beyer, E. M. (1976). Effect of Silver Ion, Carbon Dioxide, and Oxygen on Ethylene Action and Metabolism. Plant Physiology, 63, 169-173.
    6. Bowler, C., Alliotte, T., Loose, M. D., Montagu, M. V. & Inze, D. (1989). The induction of manganese superoxide dismutase in response to stress in Nicotiana plumbaginifolia. The EMBO Journal, 8, 31 – 38.
    7. Bradford, M. M. (1976). A dye binding assay for protein. Annals of Biochemistr, 72, 248-254.
    8. Castilho, R. F., Meinicke, A. R., Almeida, A. M., Hermes-Lima, M. & Vercesi, A.E. (1994). Oxidative damage of mitochondria induced by Fe (II) citrate is potentiated by Ca+2 and includes lipid peroxidation and alteration in membrane proteins. Archives of Biochemistry and Biophysics, 308, 158-163.
    9. Chang, S., Puryear, J. & Cairney, K. (1993). A simple and efficient method for isolating RNA from pine trees. Plant Molecular Biology Reporter, 11, 113-116.
    10. Clairbone, A. (1985). Catalase activity - Handbook of Methods for Oxygen Radical Research. (pp, 283-284.) Boca Raton, CRC Press..
    11. Clarke, S. M., Mur, L. A., Wood, J. E. & Scott, M. (2004). Salicylic acid dependent signaling promotes basal thermo tolerance but is not essential for acquired thermo tolerance in Arabidopsis thaliana. Plant Journal, 38, 432-447.
    12. Coolbear, P.. (1995). Mechanisms of seed deterioration, Seed quality: basic mechanisms and agricultural implications, Food Products Press, 223-277.
    13. Corbineau, F., Xia, Q., Bailly, C. & El-Maarouf-Bouteau, H. (2014). Ethylene, a key factor in the regulation of seed dormancy. Frontiers in Plant Science, 5, 1-13.
    14. Dong, X. (2004). NPR1, all things considered. Current Opinion in Plant Biology, 7, 547-552.
    15. El Tayeb, M. A. (2005). Response of barley grains to the interactive effect of salinity and salicylic acid. Plant Growth Regulation, 45, 215-224.
    16. Forcella, F., Benech Arnold, R. L., Sanchez, R. & Ghersa, C. M. (2000). Modeling seedling emergence. Field Crop Research, 67(2), 123-139.
    17. Giannopolitis, C. N. & S. K. (1977). Superoxide dismutases, I, Occurrence in higher plants. Plant Physiology, 59, 309-314.
    18. Haji Abbasi, M., Tavakkol Afshari, R Abbasi, A. R & Kamaei, R. (2020). The effect of ACC and salicylic acid on germination and GAI1 and LOX2 genes expression in deteriorated soybean seeds (Glycine max). Iranian Journal of Seed Research, 6(2), 61-79.
    19. Hampton, J. G. & Tekrony, D. M. (2005). Handbook of vigour test methods (3rd ed). The International Seed Testing Association, 70-72.
    20. Ievinsh. G. (1992). Soluble lipoxygenase activity in rye seedlings as related to endogenous and exogenous ethylene and wounding. Plant Science, 82, 155-159.
    21. International Seed Testing Association. (2009). International Rules for Seed Zurichtstr.50. CH 8303, Bassersdorf, Switzerland.
    22. Job, C., Rajjou, L., Lovigny, Y., Belghazi, M. & Job, D. (2005). Patterns of protein oxidation in Arabidopsis seeds and during germination. Plant Physiology, 138, 790–802.
    23. Johnson, C., Boden. E. & J. (2003). Salicylic acid and NPR1 induce the recruitment of trans-activating TGA factors to adefense gene promoter in Arabidopsis. Plant Cell, 15,1846–58.
    24. Kibinza, S., Bazin, J., Bailly, C., Farrant, J. M., Corbineau, F. & El-Maarouf-Bouteau, H. (2011). Catalase is a key enzyme in seed recovery from ageing during priming. Plant Science,181, 309–315.
    25. Kieber, J. J., Rothenburg, M., Roman, G., Feldmann, K. A. & Ecker, J. R. (1993). CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the raf family of protein Cell, 72, 427-441.
    26. Kozarewa, I., Cantliffe, D. J., Nagata, R. T. & Stoffella, P. J. (2006). High maturation temperature of lettuce seeds during development increased ethylene production and germination at elevated temperatures. American Horticulture Science, 131, 564–570.
    27. Lee, G. J., Wu, X., Shannon, J. G., Sleper, D. A. & Nguyen, H. T. (2007). Genome mapping and molecular breeding in plants. In Oilseeds, Volume II, ed. Kole, C. Springer-Verlag Berlin Heidelberg, 21-53.
    28. Malenčić, D. J., Vasić, D., Popović, M. & Dević, D. (2004). Antioxidant systems in sunflower as affected by oxalic acid. Biologia Plantarum, 48, 243-247.
    29. Marshal, A. H., & Lewis, D. N. (2004). Influence of seed storage conditions on seedling emergence, seedling growth and dry matter production of temperature forage grasses. Seed Science and Technology, 32(2), 493-501.
    30. Masia, A. (1998). Superoxide dismutase and catalase activities in apple fruit during ripening and post-harvest and with special reference to ethylene. Physiologia Plantrum, 104, 668-672.
    31. Matilla, A. J. (2000). Ethylene in seed formation and germination. Seed Science Research, 10, 111-126.
    32. Mc Donald, M. B. 1999. Seed deterioration: physiology, repair and assessment. Seed Science and Technology, 27(1), 177-237.
    33. McDonald, M. B. (2004). Orthodox seed deterioration and its repair. In Handbook of seed physiology applications to agriculture. Food Products Press. Volume II, ed. Benech, R.L. and Sanchez, R.A. (Food Products Press, 2004), pp.273-304.
    34. McGivern, J. J., Ganger, M. T., & Ewing, S. J. (2013). FT and NPR1 expression patterns in Arabidopsis thaliana during flowering and in response to salicylate. Preliminary Report BIOS, 84(4), 241-249.
    35. Mira, S., Estrelles, E., Gonzalez-Benito, M. E. & Corbineau, F. (2011). Biochemical changes induced in seeds of Brassicaceae wild species during ageing Acta Physiologiae Plantarum, 33, 1803–1809.
    36. Mou, Z., Fan, W. & Dong, X. (2003). Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes. Cell, 113, 935–944.
    37. Nandi, A., Kachroo, P., Fukushige, H., Hildebrand, D. F., Klessig, D. F. & Shah, J. (2003). Ethylene and jasmonic acid signaling affect the NPR1-Independent expression of defense genes without impacting resistance to Pseudomonas syringae and Peronospora parasitica in the Arabidopsis ssi1 Molecular Plant-Microbe Interactions, 16. 588–599.
    38. Narayana Murthy, U. M., Prakash, P. K. & Wendell, Q. S. (2002). Mechanisms of seed aging under different storage conditions for vigna radiate (L.) Wilczek: lipid peroxidation, sugar hydrolysis, maillard reactions and their relationship to lass state transition. Journal of Experimental Botany, 54 (348), 1057-1067.
    39. Novika, G. V., Moshkov, I. E., Smith, A. R. & Hall M. A. (2000). The effect of ethylene on MAPkinase-like activity in Arabidopsis thaliana. FEBS Lett, 474(1), 29-32.
    40. Ouaked, F., Rozhon, W., Lecourteux, D. & Hirt, H. (2003). A MAPK pathway mediates ethylene signaling in plants. EMBO Journal, 22(6), 1282-1288.
    41. Paula, M. D., Perez-Otaola, M., Darder, M., Torres, M., Frutos, G., & Martinez-Honduvilla, C. J. (1996). Function of ascorbate-glutathione cycle in aged sunflower seeds. Physiologia Plantarum, 96, 543-550.
    42. Polle, A., Otter, T. & Seifert, F. (1994). Apoplastic peroxidases and lignification in needles of Norway spruce (Picea abies). Plant Physiology, 106, 53–60.
    43. Rivas-San Vicente, M. & Javier Plasencia, J. (2011). Salicylic acid beyond defense: Its role in plant growth and development. Journal of Experimental Botany, 62(10), 3321–3338.
    44. Sharma, S., Virdi. P., Gambhir, S. & Munshi, S. K. (2005). Changes in soluble sugar content and antioxidant enzymes in soybean seeds stored under different storage conditions. Agricultral Biochemistry, 18, 9–12.
    45. Shelar, V. R., Shaikh, R. S. & Nikam, A. S. (2008). Soybean seed quality during storage: A review. Agricultural Reviews, 29(2), 125-131.
    46. Stewart, R. R. C. & Bewley, D. J. (1980). Lipid peroxidation associated with accelerated aging of soybean axes. Plant Physiology, 65, 245-248.
    47. Tada, Y., Spoel, S. H., Pajerowska Muhktar Mou, K. Z. & Song, J. (2008). Plant immunity requires conformational changes of NPR1 via S-nitrosylation and thioredoxins. Science, 321, 952–56.
    48. Van Loon, L.C., Rep, M. & Pieterse, C. M. J. (2006). Significance of Inducible Defense-related proteins in infected plants. Phytopathology, 44, 135-162.
    49. Vranova, E., Inze, D. & Breusegem, V. (2002). Signal transduction oxidative stress. Journal of Exprimental Botany, 53(372), 1227-1236.
    50. Wettlaufer, S. & Leopold, A. C. (1991). Relevance of amadori and maillard products to seed deterioration. Plant Physiology, 97, 165-1 69.
    51. Yin, X., Chen, K., Allan, A. C., Wu, R. M., Zhang, B., Lallu, N. & Fergu­son, I. B. (2008). Ethylene-induced modulation of genes associated with the ethylene signaling pathway in ripening kiwifruit. Journal of Experimental Botany, 59 (8), 2097–2108.
دوره 53، شماره 3
مهر 1401
صفحه 199-218
  • تاریخ دریافت: 27 شهریور 1398
  • تاریخ بازنگری: 14 فروردین 1400
  • تاریخ پذیرش: 25 فروردین 1400
  • تاریخ اولین انتشار: 01 مهر 1401