کارآمدی ژن‌های مقاومت به بیماری ساق سیاه (Leptosphaeria maculans) انتقال یافته از نخود فرنگی (Pisum sativum) به کلزا (Brassica napus)

نوع مقاله : مقاله پژوهشی

نویسندگان

1 فارغ التحصیل دکتری، گروه زراعت و اصلاح نباتات، دانشکدگان کشاورزی و منابع طبیعی دانشگاه تهران

2 دانشیار گروه زراعت و اصلاح نباتات، دانشکدگان کشاورزی و منابع طبیعی دانشگاه تهران

3 استاد گروه زراعت و اصلاح نباتات، دانشکدگان کشاورزی و منابع طبیعی دانشگاه تهران

چکیده

بیماری ساق سیاه که توسط قارچ Leptosphaeria maculans ایجاد می‌شود، تولید کلزا را در ایران و جهان، به‌شدت تحت تأثیر قرار می‌دهد. در این پژوهش، سه ژن PR10.1، Chitinase و DRR206 از نخود فرنگی (Pisum sativum) به کلزا منتقل شد و کارایی آن‌ها در ایجاد مقاومت به بیماری ساق سیاه در قالب دو آزمایش، مورد بررسی قرار گرفت. در آزمایش اول، سه تراژن از لاین تراریخت‌ Wester کلزا، از طریق آمیزش برگشتی، به چهار رقم زراعی Sentry، OAC Triton، Apollo وMillenniUM 03 منتقل شدند و تأثیر پس‌زمینه‌ ژنتیکی سه رقم مختلف بر پاسخ به بیماری، بررسی شد در آزمایش دوم و جهت مطالعه تأثیر تجمیع دو به دوی تراژن‌ها بر سطح مقاومت، لاین‌های مختلف وستار تراریخت با یکدیگر آمیزش داده شدند. غربالگری گلخانه‌ای بیماری ساق سیاه به روش مایه‌زنی لپه صورت گرفت. تراژن DRR206 در رقم‌ Sentry و ترکیب دو تراژن Chitinase×DRR206، بالاترین مقاومت را ایجاد کرد. به‌طورکلی تراژن DRR206، بهترین عملکرد را در کاهش بیماری داشت که به نظر می‌رسد، این تأثیر از طریق به تأخیر انداختن مراحل اولیه توسعه‌ بیماری صورت می‌گرفت. لاین‌های امیدبخش حاصل از این پژوهش، پس از آزمایش‌های مزرعه‌ای، قابلیت به‌کارگیری در برنامه‌های به‌نژادی آزادسازی رقم را خواهند داشت.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Efficacy of blackleg )Leptosphaeria maculans( resistance genes transferred from pea (Pisum sativum) to canola (Brassica napus)

نویسندگان [English]

  • Ahad Baghery 1
  • Alireza Abbasi 2
  • Hasan Zeinali Khanghah 3
  • Valiollah Mohammadi 2
1 Agronomy and Plant Breeding Department, College of Agriculture and Natural Resources, University of Tehran, Iran
2 Agronomy and Plant Breeding Department, College of Agriculture and Natural Resources, University of Tehran, Iran
3 Faculty of Agricultural Sciences and Engineering, University of Tehran
چکیده [English]

Blackleg caused by Leptosphaeria maculans is one of the important diseases widely affecting canola production worldwide. Effectiveness of three plant defence related genes transferred from pea (Pisum sativum) to canola was tested against blackleg in two experiments. In the first experiment, three transgenes including PR10.1, Chitinase, and DRR206 were transferred from transgenic Wester variety into four commercial cultivars (Apollo, Sentry, OAC Triton, and MillenniUM 03) via backcrossing to examine the effects of different genetic backgrounds on disease response. In the second experiment, to study the effect of gene pyramiding on level of disease resistance, three transgenic Wester lines were crossed. Cotyledon inoculation was performed for indoor disease screening tests of blackleg. DRR206 in Sentry and Chitinase×DRR206 appeared to be the best combinations conferring disease resistance. Overall, DRR206 had the highest impact on disease, probably due to delayed infection development. Promising lines of this research could be utilized in breeding programs and cultivar release projects after field trials.

کلیدواژه‌ها [English]

  • Chitinase
  • disease screening
  • DRR206
  • PR10.1
  • transgenic plants

مقدمه

کلزا (Brassica napus L.) به دلیل عملکرد و کیفیت بالای روغن، نقش مهمی در تأمین روغن خوراکی ایران و جهان دارد. آمارهای فائو نشان می‌دهد که در سال 2014، کلزا با 49 درصد کل تولید، مهم‌ترین منبع تولید روغن نباتی ایران بوده است (http://www.fao.org/faostat/en/#data/QD).

بیماری قارچی ساق سیاه، یکی از تنش‌های زنده‌ بسیار مهم کلزاست که می‌تواند خسارت‌های عمده‌ای را به تولید این گیاه وارد کند. این بیماری، عامل مهم تهدید زراعت کلزا در آمریکای شمالی، اروپا و چین است (Wang et al., 1999) و در ایران نیز یکی از بیماری‌های مهم کلزا به شمار می رود. میزان خسارت این بیماری در ایران تا ۴۰ درصد هم گزارش شده است (Abravan et al., 2016) و محققان متعددی در ایران آن را گزارش کرده‌اند (Fernando et al. 2007; Mirabadi et al. 2009). ساق سیاه، یک بیماری دانه‌زاد است که توسط قارچ Leptosphaeria maculans ایجاد می‌شود. فرم غیر جنسی این قارچ، Phoma lingam نامیده می‌شود. این قارچ، برگ‌ها، ساقه، و غلاف‌ها را مورد حمله قرار می‌دهد و باعث شانکر ساقه، باریک شدن موضعی آن و در نهایت شکستگی و خوابیدن بوته می‌شود. علایم بیماری در گیاه شامل زخم‌های کمرنگ بر روی لپه‌ها، برگ‌ها و ساقه می‌باشد. زخم‌ها به تدریج متمایل به رنگ خاکستری می‌شوند که حاوی پیکنیدیای تیره رنگ در وسط است. زخم‌ها اغلب دارای حاشیه‌های تیره رنگ یا متمایل به ارغوانی هستند و تبدیل به حلقه شانکر خشک و باریک در نزدیکی سطح خاک و یا بالاتر می‌شوند. این وضعیت شانکر در ساقه، عامل اصلی افت عملکرد ناشی از بیماری ساق سیاه به شمار می‌رود. بوته‌هایی که تحت تأثیر شدید این بیماری واقع می‌شوند، شکسته می‌شوند و قبل از تولید دانه از بین می‌روند (Wang & Fristensky, 2001).

قارچ عامل بیماری ساق سیاه، در بقایای بوته‌های آلوده زمستان‌گذرانی می‌کند و در فصل بعد، ساختارهای جنسی حامل اسپور تولید می‌کند. آلودگی‌های جدید، منجر به تولید پیکنیدیا می‌شود که حجم انبوهی از اسپورهای تابستانی آلوده کننده یا همان پیکنیدیوسپور را رها می‌کنند؛ آلودگی‌های دانه‌زاد نیز امکان‌پذیر است. انتشار بیماری ساق سیاه، از طریق دانه‌های آلوده، اسپورهایی که به همراه قطرات باران به اطراف پاشیده می‌شوند و یا توسط باد در مزرعه صورت می‌گیرد.

واریته‌های کلزا و جدایه‌های قارچ عامل ساق سیاه، بر طبق الگوی "ژن-به-ژن" عمل می‌نمایند، به‌طوری‌که ژن‌های مقاومت گیاهی (R)، مکمل ژن‌های غیر بیماری‌زایی پاتوژن (Avr) هستند. ژن‌های متعددی به عنوان ژن‌های مقاومت به این بیماری در کلزا شناسایی و بعضاً کلون شده‌اند. از جمله Rlm4 (Raman et al., 2012; Tollenaere et al., 2012). ژن‌های مقاومت Rlm1 تا Rlm9 و نیز LepR1 تا LepR4 با منشأهای مختلفی در گونه‌های مختلف کلزا از قبیل Brassica napus، Brassica rapa، Brassica nigra و Brassica juncea تاکنون شناسایی شده‌اند (Yu et al., 2012). ژن‌های غیر بیماری‌زایی که حضور آن‌ها در پاتوژن، موجب واکنش به موقع و کارآمد گیاه می‌شود، از جمله ژن AvrLepR1 در این قارچ، شناسایی شده است (Ghanbarnia et al., 2012). همچنین ژن‌های غیر بیماری‌زای AvrLm1 و AvrLm6 نیز کلون شده‌اند (Fudal et al., 2007).

یکی از بهترین راه‌ها جهت کنترل بیماری ساق سیاه، استفاده از واریته‌های مقاوم می‌باشد. از سایر شیوه‌ها از جمله کنترل بیولوژیک، تناوب زراعی، کنترل علفهای هرز، عملیات زراعی، رعایت بهداشت بذرها و مزرعه، سموم شیمیایی (ضد عفونی دانه) و مدیریت فراگیر آفت (Integrated Pest Management) می‌توان در جهت کنترل این بیماری بهره برد. (Wang & Fristensky, 2001)

تصور می‌شود که ژن‌های دخیل در مقاومت گیاه نخود فرنگی به قارچهای بیماری‌زا، در صورت انتقال به کلزا بتوانند سطح مقاومت این گیاه را نیز به این بیماری بهبود بخشند. در این صورت، با ثبت و تجاری سازی ارقام کلزای حاوی این ژن‌های منشأ گرفته از نخود فرنگی، می‌توان به تولید پایدار کلزا و در نتیجه افزایش تولید روغن‌های خوراکی و صنعتی در کشور، امیدوارتر بود. تعدادی لاین تراریخت کلزا (واریته Westar) حاوی سه ژن مرتبط با مقاومت به بیماری با منبع نخود فرنگی (PR10.1، Chitinase و DRR206) قبلاً تولید و ارزیابی شده است (Wang et al., 1999). مواد گیاهی تراریخت مورد استفاده در این پژوهش، شامل ژنوتیپ‌های کلزای حاوی یکی از سه ژن بیگانه مقاومت به بیماری ساق سیاه، فرصتی را برای کاوش بیشتر میزان مفید بودن این ژن‌های بیگانه برای کنترل بیماری ساق سیاه در زمینه‌های ژنتیکی متنوع فراهم می‌کند. این پژوهش، دو هدف عمده داشت که از طریق دو آزمایش پیگیری شد: انتقال این سه تراژن به واریته‌های تجاری کلزا و ارزیابی سطح مقاومت آن‌ها در آزمایش اول و هرمی کردن یا تجمیع دو به دوی این تراژن‌ها و ارزیابی سطح مقاومت آن‌ها در آزمایش دوم بررسی شد.

 

مواد و روشها

مواد گیاهی

پنج واریته کلزا به نام‌های Westar، OAC Triton، Apollo، Sentry و MillenniUM 03 که از گروه علوم گیاهی دانشگاه مانیتوبای کانادا دریافت شده بودند، مورد استفاده قرار گرفتند که از میان آن‌ها، واریته‌ Westar غیر تراریخت بود و به عنوان کنترل منفی استفاده شد و چهار واریته دیگر به عنوان گیرنده سه تراژن در این پژوهش مورد استفاده قرار گرفتند. ویژگیهای لاین‌های مختلف واریته تراریخت Westar حاوی یکی از سه تراژن معرفی شده در جدول 1 آمده‌اند. آزمایش‌ها در فاصله سالهای 2006 تا 2015 انجام شدند.

آزمایش اول

انتقال سه تراژن (GN1، GN2، و GN3) به چهار واریته تجاری کلزا (OAC Triton، Apollo، Sentry و MillenniUM 03)، از طریق تلاقی بین لاین‌های تراریخت‌ فوق و واریته‌های تجاری و سپس انجام تلاقی برگشتی صورت گرفت (شکل 1). اولین سری غربالگری بیماری (Disease screening) در مرحله هتروزیگوت (به بیان دقیق‌تر: همی‌زیگوت یا Hemizygous) انجام گرفت. سپس بوته‌ها برای گزینش افراد هموزیگوت، خودگشن شدند و در پی آن، غربالگری بیماری در مرحله هموزیگوت انجام شد.

 

 

جدول 1- سه ژن بیگانه مقاومت به بیماری در سه لاین تراریخت واریته وستر کلزا با منشأ نخود فرنگی.

Table 1. Three disease resistance transgenes originated from pea in three transgenic lines of canola Westar cultivar

Transgene

Name

Function

GN1

PR10.1

P. sativum pathogenesis-related protein;

477bp; GenBank locus: X13383;

Ribonuclease-like protein.

GN2

Chitinase

P. sativum chitinase class I (chi2) gene

976bp; GenBank locus: PEACHI2I;

Degradation of fungal cell wall.

GN3

DRR206

P. sativum disease resistance response protein;

555bp; GenBank locus: AF115574;

Strengthening cell wall, lignin biosynthesis.

 

 

تلاقی به صورت دستی و با حذف کاسبرگ‌ها، گلبرگ‌ها و پرچم‌های والد ماده در مراحل آخر غنچه‌دهی (قبل از شکفتن گل) انجام شد و پس از ان کلاله‌ها با گرده والد نر آغشته شدند. جهت جلوگیری از ورود گرده‌های ناخواسته، گل‌های دورگ‌گیری شده با پاکت پلاستیکی پوشانیده شدند. نسل BC2S2 تحت آزمایش هموزیگوسیتی از طریق انتخاب مستقیم برای تراژن مربوطه با استفاده از PCR و آغازگرهای اختصاصی قرار گرفت که طی آن، حداقل 24 گیاه برای حضور تراژن آزمایش شدند و خانواده‌هایی که تفرق نشان ندادند، یعنی همگی مثبت شدند، به عنوان ژنوتیپ هموزیگوت شناخته شدند. دو بار آزمون غربالگری گلخانه‌ای برای بیماری‌ها انجام گرفت؛ یک بار در مرحله هتروزیگوت که گیاهان نسل BC2 که مخلوطی از ژنوتیپ‌های Aa و aa بودند، پس از حذف بوته‌های aa توسط PCR تحت بیماری‌سنجی قرار گرفتند و بار دوم در مرحله هموزیگوت که گیاهان نسل BC2S2 که عدم تفرق آن‌ها با PCR تأیید شد و ژنوتیپ AA داشتند.

برای مقایسه پاسخ به بیماری ساق سیاه در مرحله هتروزیگوت، آزمایش اول آزمایش عاملیل در قالب طرح کاملاً تصادفی انجام شد و تبدیل داده به صورت تبدیل به جذر به منظور نرمال کردن توزیع خطاهای آزمایشی و یکنواخت کردن واریانس خطاها انجام شد. مواد گیاهی طی نسلها بر اساس شکل 1 مدیریت شدند تا به مرحله هموزیگوتی رسیدند. اطمینان از هموزیگوت بودن آن‌ها بر اساس عدم تفرق ژنی در لوکوس مربوطه با انجام غربالگری PCR در نتاج آن‌ها حاصل شد.

 

Second series of indoor screening for disease resistance, homozygous stage

 

First series of indoor screening for disease resistance, heterozygous stage

 

 

شکل 1- دورگ‌گیری‌ها، تلاقیهای برگشتی و خودگشنی‌ها و نیز آزمایش‌های غربالگری بیماری در آزمایش اول. AA واریته وستر تراریخت و aa واریته تجاری فاقد تراژن یا نول است.

Figure 1. Crosses, backcrosses and selfings, as well as disease screening tests in Experiment 1. AA is the transgenic cultivar of Westar and aa is the commercial cultivar lacking the transgenes(null).

 

 

همان گونه که در شکل 1 نشان داده شد، انتظار می‌رفت که نسلهای BC1 و BC2، مخلوط 50:50 از دو ژنوتیپ Aa و aa باشند. هدف این بود که تنها ژنوتیپ‌های Aa نسل بعد را ایجاد کنند؛ بنابراین از PCR برای گزینش ژنوتیپ‌های Aa استفاده شد. گیاهان BC2 با استفاده از پاکت‌های پلاستیکی، خودبارور شدند تا نسل BC2S1 تولید شود که مخلوطی از ژنوتیپ‌های AA، Aa، و aa بودند. گیاهان aa از طریق غربالگری PCR حذف شدند، ولی گیاهان AA و Aa دوباره خودبارور شدند تا نسل BC2S2 تولید شوند تا ژنوتیپ‌های AA و Aa نسل BC2S1 از هم تشخیص داده شوند.

آزمایش دوم

جهت هرمی کردن  Pyramid)یا تجمیع دو به دوی( تراژن‌ها در Westar و ارزیابی سطح مقاومت آن‌ها، ژنوتیپ‌های حاوی این ژن‌ها دو به دو با هم تلاقی داده شدند. با فرض این که هر کدام از دو والد در یک تلاقی، برای یکی از تراژن‌ها هموزیگوت و برای دیگری خالی یا نول بودند، نتاج این تلاقی‌ها انتظار می‌رفت که برای هر دو مکان ژنی هتروزیگوت (در واقع، همی‌زیگوت) باشد. اولین مرحله غربالگری بیماری در مرحله هتروزیگوت صورت گرفت. به‌منظور انتخاب هموزیگوت‌ها، خودباروری انجام شد و پس از آن، غربالگری بیماری در مرحله هموزیگوت اجرا شد (شکل 2). برای هر کدام از ترکیبات دو به دوی لاین‌های والدینی تراریخت، تلاقی انجام شد؛ آن گاه گیاهان حاصل از بذور F3 نیز نسبت به حضور تراژن‌ها از طریق PCR بررسی شدند و خانواده‌هایی که تفرق نشان دادند (در حداقل 24 بوته) کلاً حذف شدند و آن‌هایی که تفرق نشان ندادند به‌عنوان ژنوتیپ‌های هموزیگوت، تحت آزمایش‌های غربالگری گلخانه‌ای برای بیماری قرار گرفتند. یادآوری می‌شود که در مرحله هتروزیگوت نیز بیماری‌سنجی برای گیاهان F1 انجام شد.

 

 

Second series of indoor screening for disease resistance, homozygous stage

 

First series of indoor screening for disease resistance, heterozygous stage

 

شکل 2- دورگ‌گیری‌ها و خودگشنی‌ها و نیز آزمایش‌های غربالگری بیمار  در آزمایش دوم. AAaa و BBbb، دو لاین وستر تراریخت حاوی دو تراژن متفاوت و aa و bb رقم های تجاری فاقد آن تراژن یا نول هستند.

Figure 2. Crosses and selfings, as well as disease screening tests in the second experiment. AAaa and BBbb are the transgenic lines of Westar and aa and bb are the commercial cultivars lacking the transgenes(null).

 

 

برای بررسی تأثیر پس‌زمینه‌های ژنتیکی مختلف بر روی کارکرد تراژن‌ها علیه بیماری ساق سیاه در مرحله هموزیگوتی، یک آزمایش عاملیل در قالب طرح کاملاً تصادفی با 24 تکرار انجام شد. یکی از عامل‌ها تراژن در شش سطح (GN1+، GN1-، GN2+، GN2-، GN3+، و GN3-) و دیگری واریته تجاری در چهار سطح بود.

 

غربالگری حضور تراژن‌ها به روش PCR

استخراج DNA برای PCR

استخراج DNA با تغییرات جزئی در پروتکل معرفی شده توسط Wang & Fristensky, ( 2001) انجام شد. قطعات برگ گیاهان موضوع غربالگری، در داخل میکروتیوب‌های 5/1 میلی لیتری شناور در نیتروژن مایع با استفاده از میله‌های پلاستیکی شبیه دسته هاون خرد شده و کاملاً کوبیده شدند و بلافاصله روی یخ قرار گرفتند. سپس 650 میکرو لیتر از بافر CTAB (100mM TRIS Ph=8, 20mM EDTA, 1.4 mM NaCl, 2% CTAB) به آن اضافه و کاملاً مخلوط شد و در حمام آبگرم (بن ماری) 65 درجه سانتیگراد به مدت 120-90 دقیقه نگهداری شد. سپس نمونه‌ها بیرون آورده شدند و به آن‌ها 650 میکرو لیتر کلروفرم اضافه شد و با استفاده از دستگاه لرزاننده ورتکس به خوبی مخلوط شدند. تیوب‌ها سپس به مدت پنج دقیقه با سرعت 15000 دور در دقیقه سانتریفوژ شدند و قسمت بالایی به تیوب جدید منتقل شد. به اندازه 6/. – 5/. برابر حجم مایع موجود در تیوب، ایزوپروپانول به آن‌ها اضافه شد و بخوبی مخلوط شد. سپس تیوب‌ها به مدت 30 ثانیه با سرعت 10000 دور در دقیقه سانتریفوژ شدند و قسمت مایع دور ریخته شد و رسوب DNA با اتانول 70 درصد شسته شدند. تیوب‌ها به طور مختصر سانتریفوژ شدند و مابقی اتانول هم با میکروپیپت حذف شد. رسوب DNA در مقدار 400 میکرو لیتر آب مقطر حل شد و به عنوان DNA الگو در PCR استفاده شد.

 

آزمایش PCR برای تعیین ژنوتیپ

با استفاده از نرم افزار Primer3 [1]آغازگرهای اختصاصی برای هر سه تراژن طراحی شد تا در غربالگری PCR برای اثبات حضور تراژن‌ها در گیاهان در طی نسل‌های مختلف مورد استفاده قرار گیرند. مخلوط مورد استفاده برای PCR عبارت بود از: یک میکرولیتر از بافر 10X که شامل مواد زیر بود:  500 میلی مول KCl، 100 میلی مول  Tris-HCl Ph= 8.3، 3/0 میکرولیتر ازMgCl2   50میلی مول، 15/0 میکرو لیتر از مخلوط dNTP هر کدام با غلظت 25 میلی مول، 15/0 میکرو لیتر آنزیم Taq polymerase، یک میکرو لیتر از DNA الگو با غلظت پنج نانو گرم بر میکرو لیتر، حجم نهایی مخلوط هر تیوب به ده میکرو لیتر با آب دیونیزه تنظیم شد (Wang & Fristensky, 2001).

توالی آغازگرهای مورد استفاده برای رهگیری تراژن‌ها با PCR به شرح زیر بود: برای GN1 آغازگر 5'GCACCTGCTATACTCTACAAAGCTC3' به همراه 5'GGCAGCCAAATTAAGCACAC3'،  استفاده شد. برای GN2 آغازگرهای 5'ACGGGGTCTATCCACAAACA3' و 5'CGGTGTCGAGAAGGATTGAT3' و برای GN3 نیز 5'TGGAAAGAATGCAGCAAATG3' به همراه 5'ACCCACGTTCAACCAGTTTT3' مورد استفاده قرار گرفت (Wang & Fristensky, 2001).

چرخه حرارتی مورد استفاده در PCR به شرح زیر بود: چهار دقیقه در دمای 94 درجه سانتی گراد که به دنبال آن 40 بار چرخه زیر تکرار شد: 45 ثانیه دمای 94 درجه سانتی گراد، 45 ثانیه دمای 55 درجه سانتی گراد و یک دقیقه دمای 72 درجه سانتی گراد. واکنش با ده دقیقه دمای 72 درجه سانتی گراد خاتمه یافت. محصولات PCR بر روی ژل آگاروز یک درصد به مدت 45 دقیقه با ولتاژ 120 ولت الکتروفورز شدند و با اتیدیوم بروماید قابل رؤیت شدند.

غربالگری گلخانه‌ای برای بیماری

آزمون کوتیلدون یا لپه بر روی گیاهچه‌های هفت تا هشت روزه به منظور بررسی اثر حضور تراژن در واریته‌ها و لاین‌های کلزا روی مقاومت به بیماری انجام شد. طرح آزمایش مورد استفاده در آزمایش اول که به‌منظور تأثیر پس‌زمینه‌های مختلف ژنتیکی بر روی پاسخ به بیماری انجام گرفت، فاکتوریل و در قالب طرح کاملاً تصادفی بود. عامل اول شامل تراژن‌ها در شش سطح (GN1+، GN1-، GN2+، GN2-، GN3+، و GN3-) و عامل دوم شامل واریته‌ها در چهار سطح بود. در آزمایش دوم (تجمیع دو به دوی تراژن‌ها) از طرح کاملاً تصادفی با چهار تیمار شامل سه ترکیب مختلف تراژن‌ها به همراه یک شاهد یعنی واریته غیر تراریخت Westar در 20 تکرار استفاده شد. داده‌ها (شاخص بیماری) با استفاده از نرم‌افزارهای SAS، SPSS و MSTATC تجزیه واریانس شدند و مقایسه میانگین‌ها به روش دانکن در سطح یک درصد انجام شد.

جهت اندازه گیری شاخص بیماری، دانه‌ها در عمق نیم سانتیمتری به‌صورت منفرد در گلدانهای 12‌تایی پر شده از مخلوط خاکی Metromix کشت شدند و به مدت هفت روز رشد داده شدند. گلدانها به‌طور روزانه آبیاری شدند و در دمای 21 درجه سانتی گراد روز و 16 درجه شب با طول روز 16 ساعت نگهداری شدند تا لپه‌ها پدیدار و کامل شدند. مخلوط معلق پیکنیدیوسپورهای قارچ Leptosphaeria maculans پاتوتایپ PG2 که خصوصیت تهاجمی دارد، با غلظت 107×2 اسپور در هر میلی‌لیتر از کشت‌های تک‌اسپوری بر روی محیط کشت V8-Agar که از زخم‌های منفرد برگی منشأ گرفته بودند، تهیه شد. هر لپه یک بار با استفاده از یک سوزن استریل زخم شد و با استفاده از میکروپیپت، ده میکرولیتر از مخلوط معلق پیکنیدیوسپور بر روی زخم ریخته شد. واکنش به بیماری 12 روز پس از تلقیح یادداشت‌برداری شد. تعیین فنوتیپ، مطابق شکل 3 و با استفاده از شاخص بیماری صفر تا نهبرای یادداشت‌برداری استفاده شد که در آن صفر به معنای خیلی مقاوم و نه به معنای خیلی حساس بود (Williams, 1985).

آزمایش‌های غربالگری بیماری در دو مرحله انجام شد؛ اول، هنگامی که تراژن‌‌های منتقل شده در مرحله هتروزیگوت بودند و دوم، زمانی که نسل‌ها تا رسیدن به مرحله هموزیگوتی تراژن‌ها در واریته‌های گیرنده، مدیریت شدند. از دیدگاه نظری، وقتی لوکوس A نسبت به a غالب است، نباید هیچ تفاوتی در فنوتیپ AA و Aa وجود داشته باشد. در مورد تراژن‌های مورد بررسی در این پژوهش، A بیانگر حضور آن تراژن و a بیانگر خالی یا نول بودن یا عدم آن بود. اگر تراژن، مقاومت علیه یک بیماری خاص را اعطا می‌کند، حضور حتی یک نسخه بیان شونده آن ژن نیز منجر به تولید محصول آن ژن و در پی آن، فنوتیپ مقاومت خواهد شد؛ بنابراین، بررسی تأثیر یک تراژن در حالت هتروزیگوت تصویر واضحی از نحوه عمل آن در حالت هموزیگوت به دست می‌دهد.

 

 

 

شکل 3- شاخص صفر تا نه مورد استفاده برای تعیین فنوتیپ گیاهان در غربالگری بیماری‌سنجی (Williams, 1985). صفر تا سه: مقاوم؛ پنج: نیمه مقاوم و هفت تا نه: حساس.

Figure 3. The 0-9 index used for phenotyping of plants during indoor disease screening tests

 (Williams, 1985)

0-3 Resistant        5: Partially resistant            7-9: Susceptible

 

 

نتایج و بحث

رهگیری تراژن‌ها با PCR در طی نسلها

استفاده از آغازگرهای اختصاصی برای PCR ابزار ارزشمندی را فراهم می‌کند که بتوان به‌طور مستقیم برای ژن مورد نظر (که در این پژوهش، تراژن‌ها بودند) گزینش کرد. پیش از هر کاری، ضروری است که حضور تراژن‌ها در لاین‌های تراریخت و عدم هر گونه توالی مشابه در واریته‌های والدینی و شاهدها یا کنترل‌های غیر تراریخت تأیید شود. این کار با انجام PCR و با استفاده از آغازگرهای اختصاصی روی نمونه‌های DNA ژنومی استخراج شده از لاین‌های تراریخت و واریته‌های تجاری عملی شد. DNA پلاسمید حاوی هر تراژن، به‌عنوان کنترل مثبت و آب به عنوان کنترل منفی استفاده شد. الکتروفورز محصولات PCR تأیید کرد که والدین تراریخت، حاوی تراژن‌های مربوطه بودند و واریته‌های تجاری، فاقد توالی‌های مشابه تراژن‌ها بودند. در غیر این صورت، توالی‌های مشابه در واریته‌های تجاری، باعث ایجاد مشکل در رهگیری تراژن‌ها در طی نسل‌های آزمایشی می‌شدند. لاین‌های والدینی تراریخت، برای تراژن مربوطه هموزیگوت (AA) هستند؛ در حالی که واریته‌های تجاری، خالی یا نول (aa) می‌باشند.

تجزیه‌های آماری پاسخ به بیماری

مرحله هتروزیگوت

همان طور که انتظار می‌رفت، هر سه لاین والدینی تراریخته دارای زمینه‌ی ژنتیکی واریته‌ Westar، حساسیت بالایی را نسبت به بیماری ساق سیاه نشان دادند (شاخص نه). این امر نشان می‌دهد که Westar با وجود داشتن یک ژن مقاومت به بیماری منتقل شده از نخود فرنگی، هنوز قادر به مقاومت علیه بیماری ساق سیاه نیست. این موضوع یکی از دلایل اصلی طراحی آزمایش نخست در این پژوهش بوده است که آیا پس‌زمینه‌های ژنتیکی مختلف برای این تراژن‌ها، قادر به اعطای سطح بالاتری از مقاومت به بیماری به واریته‌های تجاری هستند یا خیر.

برای مقایسه پاسخ به بیماری ساق سیاه در مرحله هتروزیگوت آزمایش اول، تجزیه واریانس نشان داد که اختلاف خیلی معنی‌داری بین تراژن‌ها از نظر پاسخ آن‌ها به مایه‌زنی ساق سیاه وجود داشت (جدول 2). وضعیت مشابهی نیز برای پاسخ به بیماری بین واریته‌های تجاری مورد استفاده در این آزمایش مشاهده شد. اثر متقابل معنی‌دار بین تراژن و واریته، دلالت بر این امر دارد که رفتار تراژن‌ها در واریته‌های مختلف، به‌طور معنی‌داری متفاوت بود.

 

 

جدول 2- تجزیه واریانس بیماری ساق سیاه در مرحله هتروزیگوت در آزمایش اول.

Table 2. Variance analysis of blackleg disease in heterozygous stage in Experiment 1.

Source of Variation

Degree of Freedom

Mean of Squares

Pr>F

Treatment

23

4.554***

<0.001

Transgene

5

1.974***

<0.001

Cultivar

3

23.716***

<0.001

Transgen × Cultivar

15

1.582***

<0.001

Error

552

0.025

-

Total

575

-

-

*** بیانگر اختلاف معنی‌دار در سطح 1/0 درصد است. ضریب تغییرات: 9/5 درصد.

***: significant difference at 0.1% of probability level.. CV=5.9%

 

 

به‌منظور مقایسه واضح و نزدیک پاسخ لاین‌های آزمایشی تراریخت، نتایج بیماری‌سنجی آن‌ها به همراه واریته‌‌های تجاری غیر تراریخت مربوطه در جدول 3 آورده شده است. مقایسه میانگین‌ها با روش دانکن در سطح یک درصد نشان می‌دهد که حضور GN3 در واریته‌های Sentry و MillenniUM 03 به کاهش قابل توجه بیماری ساق سیاه در آن‌ها منجر شده است. بیشترین کاهش بیماری در ترکیب GN3 و واریته Sentry دیده شد و به دنبال آن، ترکیب‌های GN1 و GN3 در MillenniUM 03 بودند. این نتایج نشان می‌دهد که پس‌زمینه ژنتیکی واریته‌های تجاری، اثر قابل توجهی بر چگونگی واکنش تراژن‌ها علیه بیماری ساق سیاه داشت. یک توضیح ممکن برای این امر، احتمالاً وجود اثر متقابل مثبت بین ژن‌های بومی و تراژن‌‌های جدیداً وارد شده می‌باشد که یک پاسخ مؤثرتر و بهنگام‌تر به بیماری را موجب می‌شوند. این اثر مثبت پس‌زمینه ژنتیکی، آینده روشنی را در مفید بودن پژوهش‌های بیشتر روی تجاری‌سازی واریته‌های حامل این تراژن‌ها نوید می‌دهد.

آزمایش دوم برای بررسی اثرات متقابل احتمالی بین تراژن‌ها در حالت تجمیع دو به دو علیه بیماری ساق سیاه بود. برای حالت هتروزیگوت، سه ترکیب مختلف بین تراژن‌های سه‌گانه به همراه واریته غیر تراریخت Westar به‌عنوان شاهد در یک طرح آزمایشی CRD مورد مقایسه قرار گرفتند. نتایج تجزیه واریانس برای بیماری ساق سیاه در جدول‌های 4 و 5 آورده شده‌اند. وجود اختلاف معنی‌دار بین تیمارها در سطح 1/0 درصد، نشان دهنده تأثیر قابل توجه تجمیع تراژن‌ها در پاسخ کلزا به این بیماری بود.

 

 

جدول 3- مقایسه میانگین‌ها بیماری ساق سیاه در مرحله هتروزیگوت در آزمایش اول.

Table 3. Mean comparison of blackleg disease in heterozygous stage in Experiment 1.

Transgene

Genetic
background

          GN1         

          GN2         

          GN3         

+

-

+

-

+

-

Sentry

6.42abc

8.54ab

6.79abc

8.38ab

2.58e

5.50bcd

Apollo

8.46ab

8.83a

8.88a

8.92a

8.92a

8.92a

OAC Triton

8.92 a

8.96a

8.88a

8.96a

8.88a

8.92a

MillenniUM 03

3.71de

4.54cd

4.75cd

5.13cd

4.17cde

5.79abcd

اعداد در مقیاس بیماری‌سنجی صفر تا نه هستند. a-e: اختلاف معنی‌دار بین میانگین‌ها با آزمون دانکن در سطح یک درصد را نشان می‌دهد.

Numbers show disease screening scores in 0 to 9 scale. a-e: Signicant difference between means using Duncen test in 1% of probability level.

 

جدول 4- تجزیه واریانس برای بیماری ساق سیاه در مرحله هتروزیگوت در آزمایش دوم.

Table 4. Variance analysis of blackleg disease in heterozygous stage in Experiment 2.

Source of Variation

Degree of Freedom

Mean of Squares

Pr>F

Treatment

3

4.325***

<0.001

Error

76

0.023

-

Total

79

-

-

*** بیانگر اختلاف معنی‌دار در سطح 1/0 درصد است. ضریب تغییرات: 7/5 درصد.

***: significant difference at 0.1% of probability level.. CV=5.7%

 

 

مقایسه میانگین‌ها (جدول 5) نشان داد که برای بیماری ساق سیاه، ترکیب GN2×GN3 بهترین نتیجه را داشت و بعد از آن، GN1×GN3 قرار گرفت. بنابراین، نتیجه‌گیری می‌شود که عملکرد نویدبخش این ژن، یعنی DRR206 در برابر بیماری ساق سیاه با این آزمایش‌ها اثبات شد و اهمیت بهره‌برداری از این ژن در برنامه‌های اصلاحی آتی برای کلزا و سایر نباتات زراعی را نشان می‌دهد.

 

 

جدول 5- مقایسه میانگین ها برای ساق سیاه در مرحله هتروزیگوت در آزمایش دوم.

Table 5. Mean comparison of blackleg disease in heterozygous stage in Experiment 2.

Transgene combination

Blackleg score*

GN1×GN2

8.8 a

GN1×GN3

6.1 b

GN2×GN3

4.1 c

Control (Non-transgenic Westar cultivar)

8.9 a

a-c: اختلاف معنی‌دار با روش دانکن در سطح احتمال یک درصد. *: مقیاس بیماری‌سنجی صفر تا نه.

Numbers show disease screening scores in 0 to 9 scale. a-c: Signicant difference between means using Duncen test at 1% of probability level.

 

 

مرحله هموزیگوت

شکل 4، نمونه‌ای از تصاویر ژل‌های الکتروفورز جهت رهگیری تراژن‌ها طی نسل‌ها را نشان می‌دهد. خانواده‌های هموزیگوت، تحت بیماری‌سنجی ساق سیاه قرار گرفتند. نتایج آزمون‌های بیماری‌سنجی برای مرحله هموزیگوت در زیر آورده می‌شود. همانطور که انتظار می‌رفت، نتایج اکثراً همانند نتایج آزمون‌های مرحله هتروزیگوتی بود، یعنی یک دوز از تراژن مورد نظر تأثیری مشابه وجود دوز دو برابر آن داشت.

برای بررسی تأثیر پس‌زمینه‌های ژنتیکی مختلف بر روی کارکرد تراژن‌ها علیه بیماری ساق سیاه در مرحله هموزیگوتی، تجزیه واریانس (جدول 6، 7) نشان داد که اختلاف بسیار معنی‌داری بین تراژن‌ها و بین واریته‌ها از نظر تأثیر روی پاسخ به بیماری وجود داشت. اثر متقابل بسیار معنی‌دار (563/1) نیز حاکی از آن است که رفتار تراژن‌ها در واریته‌های مختلف، متفاوت از هم بوده است، یعنی میزان کاهش بیماری یک تراژن، بستگی به واریته حامل آن داشت و این چیزی است که مورد سؤال این پژوهش بوده است، یعنی تأثیر پس‌زمینه ژنتیکی بر روی اثر تراژن بر روی بیماری. این امر در نتیجه هم‌افزایی مثبت یا منفی تراژن با ژن‌های بومی خود واریته می‌باشد که جزئیات این هم‌افزایی، مستلزم انجام بررسی‌ها و پژوهش‌های بیشتری است.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

شکل 4- نمونه‌ای از غربالگری PCR برای رهگیری تراژن‌ها در طی نسل‌ها با استفاده از آغازگرهای اختصاصی ژن هدف. گیاهان نشان دهنده باند، هموزیگوت یا هتروزیگوت هستند. گیاهان کلزایی که باند نداده‌اند، خالی یا نول هستند که تراژن‌ ندارند. M= نشانگر اندازه.

Figure 4. A sample of PCR screening of tracking of the transgenes during generations using specific primers of the target genes. Plants showing the bands are either heterozygous or homozygous and thosethat do not show bands are null without the transgenes. M: size marker.

 

 

مقایسه میانگین تیمارها با روش دانکن در سطح یک درصد (جدول 7) نشان داد که ترکیب GN3 با واریته Sentry کمترین بیماری ساق سیاه را داشته است و به‌دنبال آن، ترکیبات GN3 و GN1 در واریته MillenniUM 03 قرار داشت. تأثیر تراژن PR10.1 در پس‌زمینه واریته Apollo در حالت هموزیگوت مشابه حالت هتروزیگوت بود که در آن نیز این ترکیب، با دارنده بهترین نتیجه یعنی تراژن GN3 در Sentry در یک کلاس طبقه‌بندی شدند.

برای آزمایش دوم در مرحله هموزیگوت نیز آزمون‌های بیماری‌سنجی انجام شد. تیمارها، ترکیب‌های دو به دوی تراژن‌ها به اضافه واریته Westar به عنوان شاهد بودند. نتایج تجزیه واریانس  در جدول 8) آمده است. همانطور که مشاهده می‌شود ، تأثیر تیمار در سطح 1/0 درصد معنی‌دار بود.

 

 

جدول 6- تجزیه واریانس بیماری ساق سیاه در مرحله هموزیگوت در آزمایش اول.

Table 6. Variance analysis of blackleg disease in homozygous stage in Experiment 1.

Source of Variation

Degree of Freedom

Mean of Squares

Pr>F

Treatment

23

4.686***

<0.001

Transgene

5

2.214***

<0.001

Cultivar

3

24.423***

<0.001

Cultivar × Transgene

15

1.563***

<0.001

Error

552

0.027

-

Total

557

-

-

*** بیانگر اختلاف معنی‌دار در سطح 1/0 درصد است. ضریب تغییرات: 2/6 درصد.

***: significant difference at 0.1% of probability level. CV=6.2%

 

جدول 7- مقایسه میانگین‌ها بیماری ساق سیاه در مرحله هموزیگوت در آزمایش اول.

Table 7. Mean comparison of blackleg disease in homozygous stage in Experiment 1.

Transgene

Genetic background

          GN1         

          GN2         

          GN3         

+

-

+

-

+

-

Sentry

6.2c

8.6ab

6.4c

8.0b

2.4g

5.3d

Apollo

8.7ab

8.9a

8.9a

8.9a

8.9a

8.9a

OAC Triton

8.9 a

9.0a

8.9a

8.9a

8.9 a

8.9a

MillenniUM 03

3.9 f

4.6e

5.0de

5.3d

4.0f

5.6d

داده‌ها، نتایج بیماری‌سنجی صفر تا نه هستند. a-g نشانگر اختلافات معنی‌دار می‌باشد.

Numbers show disease screening scores in 0 to 9 scale. a-g: Signicant difference between means using Duncen test at 1% of probabilitylevel.

 

جدول 8- تجزیه واریانس بیماری ساق سیاه در مرحله هموزیگوت در آزمایش دوم.

Table 8. Variance analysis of blackleg disease in homozygous stage in Experiment 2.

Source of Variation

Degree of Freedom

Mean of Squares

Pr>F

Treatment

3

***3.563

<0.001

Error

92

0.023

-

Total

95

-

-

*** بیانگر اختلاف معنی‌دار در سطح 1/0 درصد است. ضریب تغییرات: 8/5 درصد

*** indicates significant difference at 0.1% of probability level. CV=5.8%.

 

 

در مرحله هموزیگوت آزمایش دوم، مقایسه میانگین تیمارها با روش دانکن در سطح یک درصد برای پاسخ به بیماری ساق سیاه انجام شد. جدول 9 نشان می‌دهد که در مورد بیماری ساق سیاه، طبقه‌بندی تیمارها مشابه حالت هتروزیگوت بود، یعنی ترکیب‌های GN1×GN3 و GN1×GN3، بهترین کاهش بیماری را داشتند.

 

 

 

جدول 9- مقایسه میانگین‌ها بیماری ساق سیاه در مرحله هموزیگوت در آزمایش دوم.

Table 9. Mean comparison of blackleg disease in homozygous stage in Experiment 2.

Transgene combination

Blackleg

GN1×GN2

8.1a

GN1×GN3

6.3 b

GN2×GN3

4.3 c

Control (Non-transgenic Westar cultivar)

8.3 a

داده‌ها، نتایج بیماری‌سنجی بر حسب شاخص بیماری صفر تا نه. a-c: اختلاف معنی‌دار در سطح یک درصد با آزمون دانکن.

Numbers show disease screening scores in 0 to 9 scale. a-c: Signicant difference between means using Duncen test in 1% of probability level.

 

 

نتیجه‌گیری کلی

تلاش‌های زیادی برای بهره‌گیری از ژن‌های بیگانه در گیاهان زراعی علیه پاتوژن‌های گیاهی انجام شده است (Verma et al., 2012). اصلاحگران برای گزینش، همیشه به دنبال تنوع هستند و اگر تنوع طبیعی در دسترس نباشد، از دورگ‌گیری و جهش استفاده می‌شود. ژن‌های مقاومت به بیماری که از یک گونه گیاهی به گونه دیگر منتقل می‌شوند، ممکن است مقاومتی را اعطا کنند که به‌طور طبیعی قبلاً در گیاه گیرنده، یافت نشده است. استفاده از ژن‌های مقاومت به بیماری از سایر گونه‌ها برایاصلاح برای مقاومت در واریته‌های کلزا ممکن است راه مفیدی برای مبارزه با بیماری ساق سیاه باشد. بیان ژن‌های بیگانه که پپتیدهای ضد میکروبی را در گونه گیرنده کد می‌کنند، یک استراتژی جایگزین برای مهندسی ژنتیک کلزا علیه پاتوژن‌های قارچی می‌باشد. این راهکار، به‌خصوص در مورد کنترل آن دسته از پاتوژن‌های کلزا جذابتر است که منابع طبیعی محدودی برای مقاومت علیه آن‌ها موجود است. به عنوان مثال، Wang & Fristensky,  (2001) نشان دادند که گیاهان کلزای تراریخت که ژن DRR206 را بیان می‌کنند، پس از مایه‌زنی با جدایه‌های مهاجم PG3 و PG4 از قارچ L. maculans شدت کمتری از بیماری ساق سیاه را در مرحله بلوغ نشان می‌دهند. همچنین محققان نشان داده‌اند که پپتیدهای ضد میکروبی غنی از سیستئین که از گیاهان استخراج می‌شوند، یک منبع بالقوه حفاظت از گیاهان علیه پاتوژن‌ها به شمار می‌روند.

 Verma et al., (2012)، نقش یک پپتید ضد میکروبی به نام PmAMP1 را که از کاج سفید غربی یا Pinus monticola منشأ گرفته است را در اعطای مقاومت به کلزا علیه پاتوژن‌های مختلف گیاهی بررسی کردند. رشته cDNA کد کننده PmAMP1 به‌طور موفقیت‌آمیز به داخل ژنوم کلزا وارد شد و بیان این ژن در داخل گیاه باعث ارتقای مقاومت آن‌ها علیه عوامل بیماری‌زای Alternaria brassicae، Leptosphaeria maculans، و Sclerotinia sclerotiorum شد.. این نتایج بیانگر آن است که ایجاد گیاهان زراعی تراریخت با استفاده از ژن PmAMP1 می‌تواند راه مؤثری برای کنترل همزمان چندین پاتوژن گیاهی باشد.

موفقیت استفاده از ژن‌های بیگانه، چه از راه اصلاح نباتات کلاسیک (تلاقی دور و اینتروگرسیون) و چه از راه‌های مهندسی ژنتیک و ترانسفورماسیون، به وفور به اثبات رسیده است که این آزمایش، نمونه‌ای از آن‌ها می‌باشد، ولی از سوی دیگر، پذیرش این گونه گیاهان به عنوان مواد غذایی، هم از جانب مصرف‌کنندگان و هم از طرف سیاست‌گذاران سلامت غذایی جامعه، باید مورد بررسی قرار گیرد.

به‌طورکلی می‌توان نتیجه‌گیری نمود که تراژن DRR206 ( یاGN3 ) در بین تراژن‌های سه‌گانه این پژوهش از نظر ارتقای مقاومت به پاتوتایپ مورد مطالعه بهترین گزینه بود. بنابراین، پیشنهاد می شود که این ژن به سایر واریته‌های کلزا و حتی سایر گیاهان زراعی نیز وارد و اثرات مشابه احتمالی آن بررسی شود. اگرچه، کارکرد دقیق این ژن و نیز دو تراژن دیگر هنوز جای پژوهش و بررسی دارد، آنچه در پژوهش جاری تأیید شد این است که DRR206 قابلیت مقابله با بیماری‌های قارچی را دارا بود. همچنین یافته‌های ما حاکی از آن بود که پس‌زمینه ژنتیکی واریته گیرنده ژن جدید، یکی از عوامل تعیین کننده میزان مقاومت می‌باشد.

آزمایش بیماری‌سنجی مزرعه‌ای، به‌عنوان گام بعدی این پژوهش پیشنهاد می شود. در صورت تایید نتایج حاصل از بیماری‌سنجی گلخانه‌ای در شرایط مزرعه‌ای، لاین‌های امیدبخش در صورت داشتن سایر خصوصیات دلخواه زراعی می‌توانند وارد برنامه‌های به‌نژادی و آزادسازی ارقام جدید شوند.

سپاسگزاری

منابع مالی این پژوهش توسط وزارت علوم، تحقیقات و فناوری جمهوری اسلامی ایران و همچنین شورای تحقیقات علوم و مهندسی طبیعی کانادا تأمین شده ست که بدین وسیله از آن‌ها سپاسگزاری می‌شود.

REFERENCE

  1. Abravan, P., Soltani, A., Majidian, M. & Mohsenabadi, G. (2016). Factors limiting canola yield and determining their optimum range by boundary line analysis. IIOABJ, 7(8), 161–167.
  2. Fernando, W. G. D., Ghanbarnia, K. & Salati, M. (2007). First report on the presence of Phoma blackleg pathogenicity group 1 (Leptosphaeria biglobosa) on Brassica napus (canola/rapeseed) in Iran, Plant Disease, 91(4), 465.
  3. Fudal, I., Ross, S., Gout, L., Blaise, F., Kuhn, M. L., Eckert, M. R., Cattolico, L., Bernard-Samain, S., Balesdent, M. H. & Rouxel, T. (2007). Heterochromatin-like regions as ecological niches for avirulence genes in the Leptosphaeria maculans genome: map-based cloning of AvrLm6. Molecular Plant-Microbe Interactions, 20(4), 459–470. doi: 10.1094/MPMI-20-4-0459.
  4. Ghanbarnia, K., Lydiate, D. J., Rimmer, S. R., Li, G., Kutcher, H. R., Larkan, N. J., McVetty, P. B. E. & Fernando, W. G. D. (2012). Genetic mapping of the Leptosphaeria maculans avirulence gene corresponding to the LepR1 resistance gene of Brassica napus. Theoretical and Applied Genetics, 124(3), 505–513. doi: 10.1007/s00122-011-1724-3.
  5. Mirabadi, A. Z., Rahnama, K. & Esmaailifar, A. (2009). First report of pathogenicity group 2 of Leptosphaeria maculans causing blackleg of oilseed rape in Iran. New Disease Report, 19, 35.
  6. Raman, R., Taylor, B., Marcroft, S., Stiller, J., Eckermann, P., Coombes, N., Rehman, A., Lindbeck, K., Luckett, D., Wratten, N., Batley, J., Edwards, D., Wang, X. & Raman, H. (2012). Molecular mapping of qualitative and quantitative loci for resistance to Leptosphaeria maculans causing blackleg disease in canola (Brassica napus). Theoretical and Applied Genetics, 125(2), 405–418. doi: 10.1007/s00122-012-1842-6.
  7. Tollenaere, R., Hayward, A., Dalton-Morgan, J., Campbell, E., Lee, J. R. M., Lorenc, M. T., Manoli, S., Stiller, J., Raman, R., Raman, H., Edwards, D. & Batley, J. (2012). Identification and characterization of candidate Rlm4 blackleg resistance genes in Brassica napus using next-generation sequencing. Plant Biotechnology Journal, 10(6), 709–715. doi: 10.1111/j.1467-7652.2012.00716.x.
  8. Verma, S. S., Yajima, W. R., Rahman, M. H., Shah, S., Liu, J.-J., Ekramoddoullah, A. K. M. & Kav, N. N. V. (2012). A cysteine-rich antimicrobial peptide from Pinus monticola (PmAMP1) confers resistance to multiple fungal pathogens in canola (Brassica napus). Plant Molecular Biology, 79(1–2), 61–74. doi: 10.1007/s11103-012-9895-0.
  9. Wang, Y. & Fristensky, B. (2001). Transgenic canola lines expressing pea defense gene DRR206 have resistance to aggressive blackleg isolates and to Rhizoctonia solani. Molecular Breeding, 2, 263–271.
  10. Wang, Y., Nowak, G., Culley, D., Hadwiger, L. A. & Fristensky, B. (1999). Constitutive expression of pea defense gene DRR206 confers resistance to blackleg (Leptosphaeria maculans) disease in transgenic canola (Brassica napus). Molecular Plant-Microbe Interactions, 12(5), 410–418. doi: 10.1094/MPMI.1999.12.5.410.
  11. Williams, P. H. (1985) Crucifer resource book. Crucifer Genetics Cooperative, University of Wisconsin.
  12. Yu, F., Gugel, R. K., Kutcher, H. R., Peng, G. & Rimmer, S. R. (2012). Identification and mapping of a novel blackleg resistance locus LepR4 in the progenies from Brassica napus × rapa subsp. sylvestris. Theoretical and Applied Genetics, Published online. doi: 10.1007/s00122-012-1919-2.

 

[1] Howard Hughes Medical Institute, Virginia, USA