علوم گیاهان زراعی ایران

علوم گیاهان زراعی ایران

ارزیابی بیوشیمیایی و مولکولی شماری از ژنوتیپ‌های لوبیا (Phaseolus vulgaris L.) در شرایط تنش خشکی

نوع مقاله : مقاله پژوهشی

نویسندگان
1 دانش آموخته کارشناسی ارشد گروه زراعت و اصلاح نباتات، پردیس کشاورزی و منابع طبیعی دانشگاه تهران
2 استاد گروه زراعت و اصلاح نباتات، پردیس کشاورزی و منابع طبیعی دانشگاه تهران
3 دانشیار گروه زراعت و اصلاح نباتات، پردیس کشاورزی و منابع طبیعی دانشگاه تهران
4 استادیار گروه زراعت و اصلاح نباتات، پردیس کشاورزی و منابع طبیعی دانشگاه تهران
چکیده
تنش خشکی، یکی از تنش‌های مهم غیرزیستی برای گیاهان از جمله لوبیا است؛ چراکه رشد، توسعه و عملکرد گیاه را تحت تاثیر قرار می‌دهد؛ بنابراین شناسایی ژنوتیپ‌های متحمل به تنش خشکی، بسیار ضروری است. یکی از راه‌های مؤثر در شناسایی ژنوتیپ‌های متحمل به تنش خشکی، بررسی بیوشیمیایی و بیان نسبی ژن‌‌های دخیل در تنش خشکی است. بدین منظور، پژوهش حاضر بر روی شماری از ژنوتیپ‌های لوبیا شامل خمین، COS-16، D81083 و KS-10012، به‌صورت فاکتوریل و در قالب طرح بلوک‌های کامل تصادفی انجام شد. تنش خشکی در سطوح تنش شدید (25% ظرفیت زراعی)، تنش ملایم (75% ظرفیت زراعی) و آبیاری نرمال (100% ظرفیت زراعی) اعمال شد و سپس صفات محتوای نسبی آب برگ، نشت الکترولیت‌ها، پرولین، مالون دی آلدهید و بیان ژن‌های NCED، CDPK1، PIP1 و NAC مورد ارزیابی قرار گرفت. نتایج نشان داد که بیشترین و کمترین میزان صفت نشت الکترولیت‌ها، به‌ترتیب به ژنوتیپ‌های خمین به میزان 66/77% و COS-16 به میزان 25% تعلق داشت. بیشترین میزان محتوای نسبی آب برگ، در ژنوتیپ COS-16 در تنش ملایم به میزان 66/80% و کمترین میزان آن، در ژنوتیپ خمین در تنش شدید به میزان 66/46% اندازه‌گیری شد. روند افزایشی میزان پرولین در تمامی ژنوتیپ‌ها، از آبیاری 100% ظرفیت زراعی نسبت به تنش ملایم و تنش شدید مشاهده شد. همچنین روند افزایشی میزان مالون‌دی‌آلدهید در تنش شدید نسبت به شاهد مشاهده شد؛ از طرفی، ژنوتیپ خمین با داشتن بیشترین میزان مالون‌دی‌آلدهید، رتبه a و ژنوتیپ COS-16 با داشتن کمترین میزان مالون‌دی‌آلدهید، رتبه f را با در نظر گرفتن آزمون توکی به خود اختصاص دادند. افزایش نسبی بیان ژن NCED، NAC  و CDPK1 در تنش شدید نسبت به تنش ملایم و  بیان نسبی متفاوت ژن PIP1 نیز در سطوح مختلف تنش (%75 و 25% ظرفیت زراعی) مشاهده شد. به‌طورکلی، از نتایج به‌دست آمده از اندازه گیری صفات می‌توان چنین استنباط کرد که در میان ژنوتیپ‌های مورد بررسی، ژنوتیپ COS-16 بیشترین و ژنوتیپ خمین کمترین میزان تحمل نسبت به تنش خشکی را دارا می‌باشند.
کلیدواژه‌ها

عنوان مقاله English

Biochemical and molecular evaluation of some beans genotypes (Phaseolus vulgaris L.) under drought stress conditions

نویسندگان English

Shokoufeh Dastneshan 1
MohammadReza Bihamta 2
Alireza Abbasi 3
Manijeh Sabokdast nodehi 4
1 Agronomy and Plant Breeding Dept., University College of Agriculture and Natural Resources, University of Tehran, Iran.
2 Agronomy and Plant Breeding Dept., University College of Agriculture and Natural Resources, University of Tehran, Iran.
3 Agronomy and Plant Breeding Dept., University College of Agriculture and Natural Resources, University of Tehran, Iran.
4 Agronomy and Plant Breeding Dept., University College of Agriculture and Natural Resources, University of Tehran, Iran.
چکیده English

Drought stress is one of the important non-biological stresses for plants such as beans because it affects the growth, development and yield of the plant. Therefore, identification of drought tolerant genotypes is very important. One of the effective ways in identifying drought tolerant genotypes is biochemical investigation and relative genes expression involved in drought stress. Therefore, the present study was performed on a number of bean genotypes including Khomein, COS-16, D81083 and KS-10012 as factorial complete randomized block design. Drought stress was applied at the levels of severe stress (25% field capacity), mild stress (75% field capacity) and normal irrigation (100% field capacity) and then the relative water content, electrolyte leakage, proline, malondialdehyde and gene expression (NCED, CDPK1, PIP1 and NAC) were evaluated. Results showed that the highest and lowest electrolyte leakage traits belonged to Khomein genotypes with 77.66% and COS-16 with 25%, respectively. The highest relative water content of leaf belonged to COS-16 genotype at mild stress of 80.66% and the lowest to khomein genotype at severe stress of 25%. Increasing trend of proline content was observed in all genotypes from 100% of irrigation to mild and severe stresses. Also, increasing trend of malondialdehyde was observed in severe stress compared to control, on the other hand, Khomein genotype with the highest malondialdehyde rank a and COS-16 genotype with the lowest malondialdehyde genotype f were considered with Tukey test. Relative increase of NCED, NAC and CDPK1 gene expression was observed in severe stress compared to mild stress. Different relative expression of PIP1 gene was also observed at different stress levels (75% and 25% of field capacity). In general, it can be concluded that among the genotypes studied, COS-16 had the highest and Khomein genotype had the least tolerance to drought stress.

کلیدواژه‌ها English

Electrolyte leakage
gene expression
malondialdehyde
proline
relative water content

مقدمه

در بین حبوبات، لوبیای معمولی (Phaseolus vulgaris L.)  به‌جهت داشتن بیشترین سطح زیر کشت و تولید، از اهمیت ویژه‌ای برخوردار است (FAO, 2013). لوبیا از محبوب‌ترین بقولات در آمریکا و آفریقای جنوبی و شرقی به حساب می‌آید.(Asfaw & Blair, 2012)  بزرگ‌ترین تولیدکننده و مصرف‌کننده لوبیا معمولی در آمریکای لاتین، برزیل، مکزیک، منطقه آند، آمریکای مرکزی و کارائیب می‌باشند (Akibode & Maredia, (2011. تنش‌های محیطی همانند خشکی، تهدید‌های جدی برای کشاورزی، تولیدات لوبیا و وضعیت طبیعی محیطی به شمار می‌آیند (Mahajan & Tuteja, 2005; (Singh, 2007.

پرولین پروتئینی است که نقش مهمی در سازگاری به تنش‌های محیطی از جمله خشکی را بازی می‌کند. این ترکیب سبب افزایش پتانسیل اسمزی سلول‌ها، حمایت از ساختار سلول و بالاخص غشاء سلولی و سایر پروتئین‌ها در مواجه به تنش اکسیداتیو و کم‌آبی می‌شود (Bohnert & Jensen, 1996; Verslues et al., (2006; Anjum et al., 2011.

کاهش محتوای نسبی آب برگ، نخست باعث بسته شدن روزنه‌ها می‌شود که نتیجه‌ آن، کاهش ورود دی اکسیدکربن به یاخته‌های مزوفیل و در نتیجه کاهش سرعت نورساخت برگ است.(Lawlor & Cornic, 2002; Baker & Rosenqvist, 2004)  تفاوت ژنوتیپی در محتوای نسبی آب، به احتمال زیاد مربوط به اختلاف در قابلیت جذب آب از خاک و یا قابلیت کنترل افت آب از طریق روزنه‌ها است .(Sinclair & Ludlow, 1985)  

محققین ثبات غشای سلولی تحت شرایط تنش رطوبتی را به‌عنوان یک جزء اصلی تحمل به خشکی در ژنوتیپ‌های مقاوم مطرح کرده‌اند که خسارت وارده به غشاهای سلولی توسط خشکی، از طریق اندازه‌گیری نشت سلولی قابل ارزیابی است(Spaeth et al., 1984; Raison et al., 1980) . پراکسیداسیون لیپیدی، برای ارزیابی میزان رادیکال آزاد مضر تحت شرایط تنش استفاده می­شود.(Mudgal et al., 2010)  مالون دی‌آلدهید در اثر پراکسیداسیون غشای سلولی تولید می‌شود (Sairam et al., 2002).

آبسیزیک اسید نقش مهمی در تنظیم وضعیت آب گیاه از طریق سلول‌های نگهبان و رشد دارد و با القای ژن‌هایی که در مسیر سنتز آنزیم‌ها و دیگر پروتئین‌های مربوط به تحمل کم آبی هستند، در تحمل گیاه به کم آبی بسیار مؤثر است (Luan, 2002; Zhu, 2002).
 ZEP، NCED، SDR1 و AAO ژن‌هایی هستند که در مسیر آنزیم‌های بیوسنتز آبسیزیک اسید نقش اساسی دارند (Audran et al., 1998; Qin & Zeevaart, 1999, 2002; Bitter et al., 2001; Cheng et al., 2002).. PIPها (Plasma membrane intrinsic proteins)  به عنوان انتقال دهنده آب، گلیسرول، ، کربن دی‌اکسید و اوره عمل می‌کنند. آکواپورین‌های PIP در پاسخ به تنش‌های غیر زنده موثر می‌باشند؛ اگرچه مطالعات، وجود پاسخ‌های متفاوت PIP‌ها و TIP‌ها (Tonoplast intrinsic proteins) روی تنش‌های شوری، خشکی و سرما را نشان می‌دهد (Forrest & (Bhave, 2007. خانواده ژنNAC  در بسیاری از قسمت‌های گیاه و در پاسخ به تنش‌های زنده و غیرزنده (Olsen et al., 2005; Christianson et al., 2010; Tran et al., 2010; Nakashima et al., 2012) فعالیت دارند. پیش بینی می‌شود که مسیر سنتز CDPK، وابسته به افزایش بیان ژن‌هایی باشند که پروتئین‌های LEA را سنتز می‌کنند Serrano et al., 2003)). فعالیت ژن‌های LEA باعث بازسازی خسارت‌های حاصل از تنش‌ها می‌‌شود (Xiong & Zhu, 2002). در مطالعه‌ای، نقش ژن NAC در تحمل به تنش غیر زنده در گیاه برنج مورد بررسی قرار گرفت و افزایش بیان این ژن در تنش خشکی و شوری بالا و دمای پایین، باعث افزایش تحمل گیاه برنج به این تنش‌های غیر زنده شد Zheng et al.,2009)). بیان ژن NAC در تحمل به تنش خشکی در گیاه نخود، باعث افزایش تحمل این گیاه به تنش‌های غیرزنده شد .(Peng et al.,2009) مشخص شده است که القای ژن PIP1;4 در آرابیدوپسیس، منجر به مقاومت به تنش سرما در ریشه های آرابیدوپسیس می‌شودLee et al., 2012) ). خشکی، سرما، شوری و هورمونها، همگی می‌توانند تغییرات خاصی را در بیان ژن های CDPK در آرابیدوپسیس، برنج، توتون و گندم ایجاد کنند ((Yoon et al., 1999; Ma and Wu, 2007; Wan et al., 2007 بیان ژن NCED سبب القای پاسخ به تنش خشکی و تنظیم بیوسنتز آبسیزیک اسید شد (Nambara and Marion-Poll, 2005; Yang and (Guo, 2007 هدف از پژوهش حاضر، بررسی بیوشیمیایی و بیان ژن‌های دخیل در تنش خشکی در شماری از ژنوتیپ‌های لوبیا می‌باشد.

 

مواد و روش‌ها

این پژوهش در گلخانه تحقیقاتی گروه زراعت و اصلاح نباتات پردیس کشاورزی و منابع طبیعی دانشگاه تهران اجرا شد. در ابتدای آزمایش، خاک مورد استفاده در این پژوهش مورد آزمون قرار گرفت (جدول 1). آزمایش به‌صورت فاکتوریل و در قالب طرح بلوک‌های کامل تصادفی انجام شد. بذرهای چهار ژنوتیپ مختلف لوبیا شامل KS-10012، COS-16، D81083 و خمین در گلدان‌های مشابه و با سه تکرار کاشته شدند و تا مرحله سه تا چهار برگی گیاهچه، به صورت یکسان آبیاری شدند و سپس تنش خشکی در سطوح آبیاری نرمال، ملایم و شدید انجام شد. تمامی ژنوتیپ‌ها از ایستگاه خمین گرفته شدند. مواردی که اسم دارند، رقم هستند و مواردی که توسط شماره مشخص شده‌اند، شماره‌ موجود در بانک بذر و وارداتی از CIAT می‌باشند. نتایج محققین حاکی از آن است که ژنوتیپ COS-16 ژنوتیپی مقاوم و ژنوتیپ خمین، ژنوتیپی حساس به خشکی می‌باشد (Broujerdnia et al., 2016).

 

 

جدول1- نتایج آزمون خاک

Table 1. Soil test results

Soil texture

EC(ds.

pH

(%)C

(%)N

(ppm)P

(ppm)K

Loam

1.3

8.5

1.3

0.12

20.6

134

 

 

سنجش صفت RWC به روش2007) (Martınez et al., و با رابطه (1) انجام شد که در این رابطه: ، وزن تر برگ، ، وزن تورژسانس برگ و ، وزن خشک برگ را نشان می‌دهند.

%RWC = [(– ) / ( – )] × 100رابطه (1)

پبرای اندازه‌گیری نشت یونی از روش (Lutts et al., (1996 و برای محاسبه آن از رابطه 2 استفاده شد که در آن: EC1، هدایت الکتریکی اولیه و EC2، هدایت الکتریکی ثانویه است

%ELI= (/)×100         رابطه (2)

اندازه‌گیری محتوای پرولین بر مبنای روش (Bates et al., 1973) انجام شد و با توجه به منحنی استاندارد پرولین در دستگاه طیف‌سنج نوری
  (Shimadzu uv-160)در طول موج 520 نانومتر، غلظت پرولین تعیین شد.مالون دی‌آلدهید توسط روش Heath & Packer, 1968)) اندازه‌گیری شد و مقدار آن در دو طول موج 532 و 600 نانومتر در دستگاه اسپکتروفتومتر (Shimadzu uv-160) خوانده شد. 

برای اندازه‌گیری بیان ژن‌ها، آغازگرهای ژن‌های مورد بررسی(9'-cis-epoxycarotenoid dioxygenase)  NCED، (nitrogen assimilation control)  NAC، (plasma membrane intrinsic proteins) PIP1 و (calcium-dependent protein kinases) CDPK1 با استفاده از داده‌های به‌دست آمده از پایگاه اینترنتی Primer3 (http://primer3.ut.ee/) و NCBI (https://www.ncbi.nlm.nih.gov/) طراحی شدند (جدول2). آغازگر مربوط به ژن مرجع اکتین (act) نیز به عنوان ژن خانه‌دار انتخاب شد.

RNA با روش ترایزول استخراج شد .برای بررسی کیفیت RNA  استخراج شده، از الکتروفورز ژل آگارز یک درصد و برای تعیین کمیت آن، از دستگاه نانودراپ استفاده شد. ساخت cDNA با توجه به دستورکار شرکت Thermo انجام شد. درستی افزایش قطعه‌ توالی از ژن مورد نظر توسط آغازگر، با استفاده از روش PCR معمولی با دستگاه ترموسایکلر تائید شد. آن‌گاه، بیان کمی ژن مورد نظر به روش واکنش زنجیره‌ای پلیمراز در زمان واقعی(REAL-TIME PCR)  در دستگاهicycler  شرکت BioRad انجام گرفت. هر واکنش زنجیره‌ای پلیمراز، شامل 10 میکرولیتر2x ، (GUASNAR) SYBR Biopars، یک میکرولیتر آغازگرهای پیشرو و پسرو)غلظت10 پیکومول)، پنج میکرولیتر cDNA و سه میکرولیتر آب مقطر بود. برنامه دستگاه در مرحله اول، 180 ثانیه دمای 95 درجه سانتی‌گراد و در مرحله دوم، 10 ثانیه دمای 95 درجه سانتی‌گراد، 10 ثانیه دمای 59 درجه سانتی‌گراد و 30 ثانیه دمای 72 درجه سانتی‌گراد به شمار 35 چرخه بود.

 

 

جدول2- آغازگر‌های طراحی شده برای واکنش زنجیره‌ای پلیمراز

Table 2. primers designed for Real-Time PCR

Number

Gene

Oligo sequences 5'→3'

1

NCED-F

AACACTCCACTACCCCAAAC

2

NCED-R

TGGGTTTAATCGGAGTTGGG

3

NAC-F

AGCAGTGTGAGAACCCAAC

4

NAC-R

CAGACAAATTTCGGGCATTCG

5

PIP1-F

CTCGGAGCTTACTTCATGGTC

6

PIP1-R

CGGTTAAGACGGTGATGTAGAG

7

CDPK1-F

GCCAGAAAAGGGTGATGTTTG

8

CDPK1-R

CTATCCTGAAAGTGCGTACCAG

9

Act-F

GTCGCTGAGATCGGAGATC

10

Act-R

GCAAATCCAGCTTTGACCAT

 

 

تجزیه آماری داده‌ها با استفاده از نرم افزار9.2  SAS و مقایسه میانگین بر پایه آزمون توکی صورت پذیرفت. همچنین به‌منظور رسم نمودار‌ها از برنامه Excel استفاده شد. داده‌های به دست آمده از واکنش زنجیره‌ای پلیمراز در زمان واقعی، با استفاده از نرم افزار REST 2009 تجزیه و تحلیل شدند.

 

نتایج و بحث

با توجه به جدول تجزیه واریانس (جدول3)، فقدان تفاوت معنی‌دار در بلوک‌ها نشان دهنده یکنواخت بودن شرایط آزمایش بود. تفاوت بسیار معنی‌دار در ژنوتیپ‌ها حاکی از آن است که ژنوتیپ‌های مورد بررسی با یکدیگر تفاوت بسیار معنی‌دار در سطح احتمال آماری یک درصد را دارا بوده‌اند و تفاوت بسیار معنی‌دار در تنش، نشان دهنده آن است که سطوح مختلف تنش در سطح احتمال آماری یک  درصد با یکدیگر متفاوت بوده‌اند. همچنین در اثر متقابل ژنوتیپ و تنش نیز تفاوت معنی‌دار برای صفت محتوای نسبی آب برگ و تفاوت بسیار معنی‌دار برای صفات نشت الکترولیت‌ها، میزان مالون دی آلدهید و پرولین مشاهده شد.

نتایج مقایسه میانگین تاثیر سطوح مختلف تنش خشکی بر صفات اندازه‌گیری شده در چهار ژنوتیپ مورد بررسی در این پژوهش در جدول4 آمده است. با افزایش میزان تنش، کاهش چشمگیر محتوای نسبی آب برگ به ثبت رسید ولی برای صفات نشت الکترولیت‌ها، پرولین و مالون دی‌آلدهید، با افزایش میزان تنش، این صفات افزایش یافتند.

محتوای نسبی آب برگ

با افزایش میزان تنش نسبت به شاهد، میزان محتوای نسبی آب برگ کاهش یافت (شکل 1)؛ این کاهش مخصوصا در تنش 25% ظرفیت زراعی بیشتر بود. بیشترین افت محتوای نسبی آب برگ در ژنوتیپ خمین مشاهده شد که در تنش شدید، به 66/46% رسید که می‌تواند دلیلی بر حساس بودن این ژنوتیپ نسبت به تنش خشکی مخصوصا در تنش‌های شدید باشد. همچنین کمترین میزان افت محتوای نسبی آب برگ به ژنوتیپ COS16 تعلق داشت که میزان آن در تنش شدید، به 54/69% رسید. روند کاهشی محتوای نسبی آب برگ در ژنوتیپ‌های D81083 و KS-10012 نیز مشاهده شد؛ به طوری که درصد محتوای نسبی آب برگ در تنش‌ ملایم (75% ظرفیت زراعی) در این دو ژنوتیپ، به‌ترتیب 43/72 درصد و 26/66 درصد و در تنش شدید (25% ظرفیت زراعی)، به‌ترتیب 61 درصد و 15/57 درصد بود.  محققان بیان کردند که کمبود آب به طور آشکاری محتوای نسبی آب را در برگ‌های لوبیا کاهش می‌دهد (Turkan et al., 2005). نتایج تحقیقات، گویای کاهش محتوای نسبی آب در شرایط تنش خشکی است؛ البته این کاهش در رقم حساس نسبت به رقم مقاوم به خشکی بیشتر است
 (Korir et al., 2006; Lizana et al., 2006). همچنین در مطالعه‌ای روی اثر کمبود آب بر گیاه عدس، کاهش محتوای نسبی آب برگ تایید شد که با نتایج حاصل از این پژوهش مطابقت دارد .(Salehpour et al., 2009) در لوبیا، ژنوتیپ‌هایی با محتوای نسبی آب بالا، عملکرد دانه بیشتری دارند و از طریق حفظ توازن آب در برگ‌ها، تنش خشکی را بهتر تحمل می‌کنند
.(Bayoumi, 2008) نتایج محققین نشان داد که در سطوح بالای تنش، ارقام متحمل COS-16 و Tylor نسبت به ارقام حساس اختر و خمین قادرند محتوای نسبی آب خود را حفظ نمایند و از صدمه کمتری ناشی از پسابیدگی و کاهش محتوای آب ببینند که با نتایج به دست آمده از این پژوهش مطابقت دارد (Broujerdnia et al., 2016).

 

 

جدول3- تجزیه واریانس صفات مورد ارزیابی در ژنوتیپ‌های لوبیا تحت سطوح مختلف تنش خشکی.

Table 3. Variance analysis of of the effects of different levels of drought stress on traits evaluated in bean genotypes.

MS

 

Proline

Malondialdehyde

Electrolyte leakage

Relative water content

Df

ANOVA

0.00012

0.000003

0.34

3.07

2

Block

0.013**

0.014**

809.127**

508.56**

3

Genotype

0.040**

0.033**

2919.685**

664.48**

2

Stress

0.001**

0.011**

27.92**

20.49*

6

Geno*Str

0.00015

0.00005

0.90

7.24

22

Erorr

8.92

6.70

2.01

4.01

 

CV%

             

 

** و *: معنادار در سطح احتمال یک و پنج درصد .

CV, ** and  *:  Coefficient of Variation Significant at 1% and 5% of probability levels, respectively.         

 

جدول4- مقایسه میانگین تاثیر سطوح مختلف تنش خشکی بر صفات اندازه‌گیری شده در چهار ژنوتیپ مورد بررسی.

Table 4. Mean comparisons of the effects of different levels of drought stress on traits evaluated in bean genotypes.

Malondialdehyde

Proline

Electrolyte leakage

Relative water content

Stress

 
 

0.06c

0.09c

33.36c

72.36a

100%FC

 

0.09b

0.12b

44.25b

70.35a

75%FC

 

0.16a

0.20a

64.12a

58.59b

25%FC

 

4.58

4.58

4.58

4.58

CV%

 

 

 

شکل1- محتوای نسبی آب برگ در تمامی ژنوتیپ‌ها در سطوح مختلف تنش (%100، %75 و 25% ظرفیت زراعی). حروف متفاوت روی نمودار، بر اساس آزمون توکی در سطح احتمال یک درصد تعیین شده‌اند.

Figure 1. The relative water content of leaves in all bean genotypes at different levels of stress (100%, 75% and 25% Field capacity). Different letters are based on the Tukey’s test at 1% of probability level.

 

نشت الکترولیت‌ها

نتایج نشت الکترولیت‌ها نشان می‌دهد (شکل2) که در تمامی ژنوتیپ‌های مورد بررسی در این آزمایش، با افزایش میزان تنش نسبت به شاهد، نشت الکترولیت‌ها افزایش یافت. همانطور که در شکل 2 مشاهده می‌شود، در تنش 25% ظرفیت زراعی، بیشترین و کمترین میزان نشت الکترولیت‌ها به‌ترتیب در ژنوتیپ خمین و COS16 به میزان 66/77 درصد و 4/52 درصد مشاهده شد که همین میزان در دو ژنوتیپ D81083 و KS-10012، به‌ترتیب 66/61 درصد و 76/64 درصد بود.

 

 

شکل2- محتوای نشت الکترولیت‌ها در تمامی ژنوتیپ‌ها در سطوح مختلف تنش (%100، %75 و 25% ظرفیت زراعی). حروف متفاوت روی نمودار بر اساس آزمون توکی در سطح احتمال یک درصدتعیین شده‌اند.

Figure 2. Electrolyte leakage content in all bean genotypes at different levels of stress (100%, 75% and 25% Field capacity). Different letters are based on the Tukey’s test at 1% of probability level.

 

 

تحت شرایط تنش رطوبتی، غشای پلاسمایی یکی از اولین بخش‌های گیاهی است که آسیب می‌بیند  (Liang et al., 2003). میزان پایداری غشای سلولی با تحمل سایر فرآیندهای گیاهی به تنش از جمله فتوسنتز مرتبط است و به‌عنوان شاخصی از تحمل به تنش ارائه شده است (Sairam et al., 2002). دیواره سلولی در اثر تنش خشکی تخریب می‌شود و مایع سلولی به فضای بین سلولی تراوش می‌کند و باعث بالا رفتن هدایت الکتریکی محلول می‌شود؛ بدین ترتیب هرچه سلول‌های بیشتری تخریب شده باشد، آن رقم مقاومت کمتری به خشکی دارد(Darvish Balochi et al., 2011). در ارزیابی مقاومت به خشکی ارقام جو، تخریب کمتری در غشاهای سلولی ارقام مقاوم‌تر به خشکی مشاهده شد و محققین بیان کردند که ثبات غشای سلولی در طول دوره تنش خشکی، ممکن است به میزان پرولین آزاد موجود در سلول مرتبط باشد (Kocheva & Georgive, 2003). حفظ تمامیت غشای سلولی در طی تنش خشکی، نشانه ای از وجود مکانیزم‌های کنترلی در تحمل به پسابیدگی است؛ بنابراین در شرایط تنش کم آبی، ارقام 16-COS و Tylor که پایداری غشای بالاتری دارند، نسبت به ارقام خمین و اختر مقاوم‌تر می‌باشند (Broujerdnia et al., 2016).

 

پرولین

نتایج به‌دست آمده برای صفت پرولین نشان داد که در تمامی ژنوتیپ‌های مورد بررسی در این آزمایش، با افزایش میزان تنش نسبت به شاهد (100% ظرفیت زراعی)، محتوای پرولین افزایش یافت (شکل 3). بیشترین افزایش پرولین در میان ژنوتیپ‌ها، به ژنوتیپ COS16 در تنش 25% ظرفیت زراعی به میزان 28/0 میکرومول بر گرم بافت تر برگی تعلق داشت. در تنش ملایم (75% ظرفیت زراعی)، افزایش پرولین در ژنوتیپ‌های مورد بررسی KS-10012، D81083، COS-16 و خمین، به‌ترتیب 1/0، 13/0، 15/0 و 08/0 میکرومول بر گرم بافت تر برگی بود.

 

 

 

شکل3- محتوای پرولین در تمامی ژنوتیپ‌ها در سطوح مختلف تنش (%100، %75 و 25% ظرفیت زراعی). حروف متفاوت روی نمودار بر اساس آزمون توکی در سطح احتمال یک درصد تعیین شده‌اند.

Figure 3. Proline content in all bean genotypes at different levels of stress (100%, 75% and 25% Field capacity). Different letters are based on the Tukey’s test at 1% of probability level.

 

 

تجمع بیشتر پرولین در گیاه لوبیا تحت تنش خشکی، نوعی سازگاری برای تحمل خشکی بود که به‌نوبه خود، به گیاه برای زنده ماندن و تکثیر در شرایط خشکی کمک کرد (Zadehbagheri et al., 2012). نتایج حاصل از پژوهشی نشان داد که اعمال تنش خشکی، باعث افزایش معنی‌داری در میزان پرولین شد (Gunes et al., 2008). تجمع پرولین، یک پاسخ فیزیولوژیکی بسیار رایج در بسیاری از گیاهان در واکنش به دامنه وسیعی از تنش‌های زیستی و غیر زیستی است .(Geravandi et al., 2011) نتایج محققین نشان داد که در تنش 30 درصد ظرفیت زراعی، بیشترین میزان پرولین در ارقام متحمل Tylor وCOS-16  و کمترین میزان آن، در ارقام حساس خمین و اختر مشاهده شد که با نتایج به‌دست آمده در این پژوهش مطابقت دارد (Broujerdnia et al., 2016).

مالون دی‌آلدهید

با افزایش میزان تنش از آبیاری 100% ظرفیت زراعی به آبیاری 25% ظرفیت زراعی، میزان مالون دی آلدهید افزایش یافت (شکل 4). بیشترین میزان این صفت در تنش 25% ظرفیت زراعی برای ژنوتیپ خمین، به‌میزان 22/0 میلی‌گرم بر گرم بافت تر برگی مشاهده شد و به‌طور‌کلی، کمترین میزان آن در آبیاری 100% ظرفیت زراعی در ژنوتیپ COS16 به میزان 03/0 میلی‌گرم بر گرم بافت تر برگی به‌ ثبت رسید. روند متفاوت افزایش مالون دی آلدهید در تمامی ژنوتیپ‌های مورد بررسی در تنش 75% ظرفیت زراعی، نشان دهنده تفاوت ژنوتیپ‌ها بود که میزان آن برای ژنوتیپ‌های KS-10012، D81083، COS-16 و خمین، به‌ترتیب 13/0، 06/0، 04/0 و 14/0 میلی‌گرم بر گرم بافت تر برگی بود.

بررسی غلظت مالون دی آلدهید بافت گیاهی می‌تواند بیانگر میزان تخریب غشاء سلولی باشد، زیرا این ترکیب، تحت تأثیر تخریب و پراکسیده شدن غشاء سلولی آزاد می‌شود (Bhattacharjee et al., 2002). محققین در نتایج پژوهشی، افزایش غلظت مالون دی آلدهید برگ را تحت تأثیر تنش شوری در ذرت گزارش نمودندGunes et al., 2007) ). وجود مقادیر بیشتر مالون دی آلدهید در ارقام حساس در مقایسه با ارقام متحمل گزارش شده است (Sairam et al., 2002).

 

 

 

 

شکل4- محتوای مالون دی‌آلدهید در تمامی ژنوتیپ‌ها در سطوح مختلف تنش (%100، %75 و 25% ظرفیت زراعی). حروف متفاوت روی نمودار بر اساس آزمون توکی در سطح احتمال یک درصد تعیین شده‌اند.

Figure 4. MDA content in all bean genotypes at different levels of stress (100%, 75% and 25% Field capacity). Different letters are based on the Tukey’s test at 1% of probability level.

 

 

بیان نسبی ژن‌ها

افزایش بیان نسبی ژن NCED در تمامی ژنوتیپ‌های مورد بررسی در تنش شدید (25% ظرفیت زراعی) نسبت به تنش ملایم (75% ظرفیت زراعی) مشاهده شد. کمترین میزان بیان نسبی ژن NCED، در تنش 25% ظرفیت زراعی برای ژنوتیپ خمین به‌میزان 9/0 برابر و بیشترین مقدار آن، در ژنوتیپ COS16 در تنش 75% ظرفیت زراعی به‌میزان 2/9 برابر بود (شکل 5). میزان بیان ژن NCED در ژنوتیپ  D81083 در تنش ملایم (75% ظرفیت زراعی) به‌میزان 9/1 برابر و در تنش شدید (25% ظرفیت زراعی) به‌میزان 1/7 برابر ثبت شد.

تنش خشکی در گیاه لوبیا معمولی، بیان ژن NCED را به‌طور قابل توجهی افزایش داد Yang et al,. 2012)). افزایش بیان ژن NCED در گیاه توتون و Arabidopsis، سبب افزایش میزان آبسیزیک اسید شد که در نهایت منجر به تحمل به خشکی در این گیاهان می‌شود (Iuchi et al., 2001; Qin & Zeevaart, 2002). در تنش کمبود آب، تجمع میزان آبسیزیک اسید در برگ‌ها که رابطه مستقیمی با افزایش بیان ژن  NCEDداشت نمایان شد (Schwartz et al., 2003; Xiong & Zhu, 2003; Nambara & Marion-Poll, 2005; Zhang et al., 2008). در نتایج پژوهشی در ژنوتیپ‌های لوبیا شامل KS-21486، KS-21191 و Goynok98، بیان ژن NCED در بافت برگ، به‌ترتیب 12، 8 و 17 برابر در مقایسه با گیاهان شاهد بروز یافت (Khodambashi et al., 2013). افزایش بیان ژن‌های NCED و ZEP و AAO با تاثیر از تنش‌های شوری و خشکی توسط محققین گزارش شد  (Audran et al., 1998; Xiong et al., 2002; Seo et al., 2000).

در مطالعه‌ای روی تاثیر تنش خشکی بر بیان ژن‌ها در ریشه لوبیا، افزایش بیان ژن آکواپورین در ریشه رخ داد که این افزایش بیان، سبب افزایش تراوایی غشای پلاسمایی و غشای واکوئول به آب و بازگشت آماس شده است (Recchia et al., 2013). القای بیان ژن AtPIP2;3 تحت تنش خشکی، یکی از موارد نخستین از بیان آکواپورین‌ها در تنش خشکی به حساب می‌آیند (Yamaguchi-Shinozaki et al., 1992). همچنین گیاهان متحمل (M. crystallinum)، تنظیم کاهشی از ژن‌های PIP نشان دادند Yamada et al., 1995)). تنش‌های خشکی و آبسیزیک اسید در گیاه لوبیا، باعث کاهش تعرق و افزایش بیان ژن‌های PVPIP2;1 شد (Aroca et al., 2006). افزایش بیان ژن PIP1 در برنج و توتون، تحمل به خشکی را افزایش داد (Lian et al., 2004; Yu et al., 2005)، در حالی که افزایش متفاوت بیان PIP1، تحمل به خشکی آن‌ها را کاهش داد (Aharon et al., 2003).

 

شکل5- میزان نسبی بیان ژن NCED در ژنوتیپ‌های لوبیا در دو سطح 25% و 75% ظرفیت زراعی.

Figure 5. Relative expression of NCED gene in bean genotypes in response to drought stress (75% and 25 % FC).

 

 

بیان نسبی ژن PIP1 در ژنوتیپ خمین در تنش های 25% و 75% ظرفیت زراعی، به‌ترتیب 3/1 و 3/9- بود؛  علاوه بر آن، همین میزان در ژنوتیپ COS-16 در تنش های 25% و 75% ظرفیت زراعی، به‌ترتیب 8/2 و 2- به دست آمده است (شکل6).

 

 

 

شکل6- میزان نسبی بیان ژن PIP1 در ژنوتیپ‌های لوبیا در دو سطح 25% و 75% ظرفیت زراعی.

Figure 6. Relative expression of PIP1 gene in bean genotypes in response to drought stress (75% and 25 % FC).

 

 

کمترین میزان بیان نسبی ژن NAC در تنش 75% ظرفیت زراعی و برای ژنوتیپ خمین به‌میزان 3/4 و بیشترین میزان آن در ژنوتیپ COS-16 در تنش 25% ظرفیت زراعی و به‌میزان 6/39 بود (شکل 7). بیان نسبی ژن NAC در ژنوتیپ KS-10012 در تنش 25% ظرفیت زراعی، 5/19 برابر و در تنش 75% ظرفیت زراعی، 1/6 برابر بود.

ژن  ONAC045در برنج توسط تنش‌های خشکی، شوری، دمای پایین و تیمار آبسیزیک اسید در ریشه و برگ القا شد (Zheng et al., 2009). ژن OsNAC6 در گیاهان تراریخته در بسیاری از تنش‌های زنده و غیر زنده بیان می شود و تحمل به تنش شوری و کم آبی افزایش می‌دهد (Nakashima et al., 2007). افزایش بیان ژن SNAC1 در گیاهچه‌های برنج تراریخته تحت تنش خشکی و شوری نسبت به گیاهان وحشی، زنده ماندن گیاهان را به‌طور معنی‌داری افزایش داد
 (Hu et al., 2006).

 

شکل7- میزان نسبی بیان ژن NAC در ژنوتیپ‌های لوبیا در دو سطح 25% و 75% ظرفیت زراعی.

Figure 7. Relative expression of NAC gene in bean genotypes in response to drought stress (75 and 25 % FC).

 

 

افزایش بیان نسبی ژن CDPK1 در تمامی ژنوتیپ‌های مورد بررسی در تنش شدید نسبت به تنش ملایم مشاهده شد. کمترین میزان بیان ژن CDPK1 نسبت به ژن شاهد در تنش 75% ظرفیت زراعی برای ژنوتیپ خمین به‌میزان 1/4 برابر و بیشترین میزان آن، در ژنوتیپ COS16  در تنش 25% ظرفیت زراعی به‌میزان 8/12 برابر می‌باشد (شکل8). میزان بیان ژن CDPK1 در ژنوتیپ D81083 در تنش 75% ظرفیت زراعی، 2/3 برابر و در تنش 25% ظرفیت زراعی، 5/9 برابر بود.

 

 

 

شکل8- میزان نسبی بیان ژن CDPK1 در ژنوتیپ‌های لوبیا در دو سطح 25% و 75% ظرفیت زراعی.

Figure 8. Relative expression of CDPK1 gene in bean genotypes in response to drought stress (75 and 25 % FC).

 

 

در نتایج تحقیقی، بیان ژن ZoCDPK1 در گیاهان توتون تراریخته در حالت تنش بیش، از حالت نرمال گزارش شد؛ بنابراین تحمل بیشتر گیاهان تراریخته تحت تنش‌های شوری و خشکی، ناشی از این امر می‌باشد (Vivek et al., 2013) .از خانواده CDPK رونویسی ژن VfCPK1 توسط تنش‌های خشکی، آبسیزیک اسید و Ca در گیاهان لوبیا کنترل شد (Liu et al., 2006). افزایش بیان ژن CDPKs ،تحمل به تنش‌های سرما، شوری و خشکی را در برنج افزایش داد (Saijo et al., 2000).

 

نتیجه‌گیری کلی

با توجه به نتایج به‌دست آمده مشخص شد که با افزایش شدت تنش، میزان محتوای پرولین، مالون دی آلدهید و نشت الکترولیت‌ها افزایش یافت. از طرف دیگر، بیان نسبی ژن‌های NCED، NAC، PIP1 و CDPK1 مخصوصا در تنش 25% ظرفیت زراعی نسبت به 75% ظرفیت زراعی، افزایش چشمگیری داشت و کاهش محتوای نسبی آب برگ نیز در تنش شدید مشاهده شد. همچنین ژنوتیپ COS16، دارای بیشترین سطح تحمل و ژنوتیپ خمین، دارای تحمل کمتری نسبت به تنش خشکی بود.

 

 

REFERENCES

  1. Aharon, R., Shahak, Y., Wininger, S., Bendov, R., Kapulnik, Y. & Galili, G. (2003). Overexpression of a plasma membrane aquaporin in transgenic tobacco improves plant vigor under favorable growth conditions but not under drought or salt stress. Plant Cell, 15, 439–447.
  2. Akibode, S. & Maredia, M. (2011). Global and regional trends in production, trade and consumption of food legume crops. Department of Agricultural, Food and Resource Economics, Michigan State University, 87p.
  3. Anjum, S. A., Xie, X., Wang, L., Saleem, M. F., Man, C. & Lei, W. (2011). Morphological, physiological and biochemical responses of plants to drought stress. African Journal Agriculture Research, 6, 2026-2032.
  4. Aroca, R., Ferrante, A., Vernieri, P. & Vernieri, P. (2006). Drought, abscisic acid and transpiration rate effects on the regulation of PIP aquaporin gene expression and abundance in Phaseolus vulgaris Annals of Botany, 98, 1301–1310.
  5. Asfaw, A. & Blair, M. W. (2012). Quantitative trait loci for rooting pattern traits of common beans grown under drought stress versus non-stress conditions. Molecular Breed, 30, 681-695.
  6. Audran, C., Borel, C., Frey, A., Sotta, B., Meyer, C., Simonneau, T. & Marion- Poll, A. (1998). Expression studies of the zeaxanthin epoxidase gene in Nicotiana plumbaginfolia. Plant Physiology, 118, 1021–1028.
  7. Baker, N. R. & Rosenqvist, E. (2004). Applications of chlorophyll fluorescence can improve crop production strategies: an examination of future possibilities. Journal of Experimental Botany, 55, 1607-1621.
  8. Bates, L. S., Waldren, R. P. & Teare, L. D. (1973). Rapid determination of free proline for water stress studies. Journal of Plant and Soil, 39, 205-208.
  9. Bayoumi, T. Y., Manal, H. & Metwali, E. (2008). Application of physiological and biochemical indices as a screening technique for drought tolerance in wheat genotypes. African Journal Biotechnol, 14, 2341-2352.
  10. Bhattacharjee, S. & Mukherjee, A. K. (2002). Salt stress induced cytosolute accumulation, antioxidant response and membrane deterioration in three rice cultivars during early germination. Seed Science and Technology, 30, 279-287.
  11. Bohnert, H. J. & Jensen, R. G. (1996). Strategies for engineering water stress tolerance in plants. Trends in Biotechnology, 14, 89–97.
  12. Bitter, F., Oreb, M. & Mendel, R. R. (2001). ABA3 is a molybdenum cofactor sulfurase required for activation of aldehyde oxidase and xanthin dehydrogenase in Arabidopsis thaliana. Journal Biology Chemistry, 276, 40381– 40384.
  13. Broujerdnia, M., Bihamta, M. R., Alamisaeid, K. & Abdusi, V. (2016). Effect of drought stress on proline content, soluble carbohydrates, electrolyte leakage and relative water content of bean (Phaseolus vulgaris). Crop Physiology Islamic Azad University of Ahvaz, 29, 23-41. (In Persian)
  14. Cheng, W. H., Endo, A., Zhou, L., Penney, J., Chen, H. C., Arroyo, A., Leon, P., Nambara, E., Asami, T., Seo, M., Koshiba, T. & Sheen, J. (2002). A unique short-chain dehydrogenase/reductase in Arabidopsis glucose signaling and abscisic acid biosynthesis and functions. Plant Cell, 14, 2723–2743.
  15. Christianson, J. A., Dennis, E. S., Llewellyn, D. J. & Wilson, I. W. (2010). ATAF NAC transcription factors: regulators of plants tresssignaling. Plant Signal Behavior. 5,428–432.
  16. Darvish balochi, M., Paknejad, F. & Ardekani, M. (2011). Effect of drought stress and some micronutrients, foliar nutrition on chlorophyll fluorescence parameters, relative water content, membrane stability and grain yield. Journal of Field Crop Science, 41, 531-543. (In Persian)
  17. FAO Statistical Yearbook. (2013). World Food and Agriculture.
  18. Forrest, K. L. & Bhave, M. (2007). Major intrinsic proteins (MIPs) in plants: A complex gene family with major impacts on plant phenotype. Function Integration Genomics, 7, 263–289.
  19. Geravandi, M., Farshadfar, E. & Kahrizi, D. (2011). Evaluation of some physiological traits as indicators of drought tolerance in bread wheat genotypes. Russian Journal of Plant Physiology, 58(1), 69-75.
  20. Gunes, A., Inal, A., Alpuslan, M., Fraslan, F., Guneri, E. & Cicek, N. (2007). Salicylic acid induced changes on some physiological parameters symptomatic for oxidative stress and mineral nutrition in maize grown under salinity. Journal of Plant Physiology, 164, 728-736.
  21. Gunes, A., Inal., A., Adak, M. S., Bagci, E. G., Cicek, N. & Eraslan, F. (2008). Effect of drought stress implemented at pre-or post-anthesis stage on some physiological parameters as screening criteria in chickpea cultivars. Russian Journal of Plant Physiology, 55 (1), 59-67.
  22. Heath, R. & Packer, L. (1968). Photoperoxidation in isolated chloroplasts. I. Kinetics and stoichiometry of fatty acid peroxidation. Biochem. Biophys, 125, 189-198.
  23. Hu, H., Dai, M., Yao, J., Xiao, B., Li, X., Zhang, Q. & Xiong, L. (2006). Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances drought resistance and salt tolerance in rice. Proceedings of the National Academy of Sciences, 103, 12987-12992.
  24. Iuchi, S., Kobayashi, M., Taji, T., Naramoto, M., Seki, M., Kato, T., Tabata, S., Kakubari, Y., Yamaguchi-Shinozaki, K. & Shinozaki, K. (2001). Regulation of drought tolerance by gene manipulation of 9-cisepoxycarotenoid dioxygenase, a key enzyme in abscisic acid biosynthesis in Arabidopsis. The Plant Journal, 27, 325–333.
  25. Khodambashi, M., Shiran, B. & Gharaghanipour, N. (2013). Differential expression of CA7 and NCED Genes in common bean genotypes under drought stress. Journal of Agricultural Science and Technology, 15, 1491-1499.
  26. Kocheva, K. & Georgive, G. (2003). Evaluation of the reaction of two contrasting Barley (Hordeum vulgare ) Cultivars in response to osmotic stress with Peg 6000. Journal Plant Physiology, 3, 290-294.
  27. Korir, P. C., Nyabundi, J. O. & Kimurto, P. K. (2006). Genotypic responses of common bean (Phaseolus vulgaris ) to moisture stress conditions in Kenya. Asian Journal of Plant Science, 5, 24-32.
  28. Lawlor, D. W. & Cornic, G. (2002). Photosynthetic carbon assimilation and associated metabolism in relation to water deficits in higher plants. Plant Cell and Environment, 25, 275-294.
  29. Lee, S. H., Chung, G. C., Jang, J. Y., Ahn, S. J. & Zwiazek, J. J. (2012) Overexpression of PIP2; 5 aquaporin alleviates effects of low root temperature on cell hydraulic conductivity and growth in Arabidopsis. Plant Physiology 159:479-488.
  30. Lian, H. L., Yu, X., Ye, Q., Ding, X. S., Kitagawa, Y. & Kwak, S. S. (2004). The role of aquaporin RWC3 in drought avoidance in rice. Plant and Cell Physiology, 45, 481–489.
  31. Liang, Y., Q. Chen, W. Liu, Z. Zhang & Ding, R. (2003). Exogenous silicone (Si) increases antioxidant enzyme activity and reduces lipid per oxidation in roots or salt- stressed barley (Hordeum Vulgare ). Journal Plant Physiology, 99, 872-878.
  32. Liu, G., Chen, J. & Wang, X. (2006). VfCPK1, a gene encoding calciumdependent protein kinase from Vicia faba, is induced by drought and abscisic acid. Plant Cell Environ, 29, 2091-2099.
  33. Lizana, C., Wentworth, M., Martinez, J. P., Villegas, D., Meneses, R., Murchie, E. H., Pastenes, C., Lercari, B., Vernieri, P., Horton, P. & Pinto, M. (2006). Differential adaptation of two varieties of common bean to abiotic stress. I. Effect of drought on yield and photosynthesis. Journal of Experimental Botany, 57, 685-697.
  34. Luan, S. (2002). Signalling drought in guard cells. Plant Cell Environ, 25, 229–237.
  35. Ma, S. Y. & Wu, W. H. (2007). AtCPK23 functions in Arabidopsisresponses to drought and salt stresses. Plant Molecular Biology, 65: 511-518.
  36. Mahajan, S. & Tuteja, N. (2005). Cold, salinity and drought stresses: an Archive Biochem Biophys, 444, 139-158.
  37. Martınez, J. P., Silva, H., Ledent, J. F. & Pinto, M. (2007). Effect of drought stress on theosmotic adjustment, cell wall elasticity and cell volume of six cultivars of common beans (Phaseolus vulgaris). Europ Journal Agronomy, 26, 30-38.
  38. Mudgal, V., Madaan, N. & Mudgal, A. (2010). Biochemical mechanisms of salt tolerance in plants: A review. International Journal of Botany, 6, 136-143.
  39. Nakashima, K., Tran, L-SP., Nguyen, D. V., Fujita, M., Maruyama, K., Todaka, D., Ito, Y., Hayashi, N., Shinozaki, K. & Yamaguchi-Shinozaki, K. (2007). Functional analysis of a NAC-type transcription factor OsNAC6 involved in abiotic and biotic stress-responsive gene expression in rice. The Plant Journal, 51, 617-630.
  40. Nakashima, K., Takasaki, H., Mizoi, J., Shinozaki, K. & Yamaguchi-Shinozaki, K. (2012). NAC transcription factors in plant abiotic stress responses. Biochim Biophys Acta, 1819, 97–103.
  41. Nambara, E. & Marion-Poll, A. (2005). Abscisic acid biosynthesis and catabolism. Annals Reiew of Plant Biology, 56, 165–185.
  42. Olsen, A. N., Ernst, H. A., Leggio, L. L. & Skriver, K. (2005). NAC transcription factors: structurally distinct, functionally diverse. Trends Plant Science, 10, 79–87.
  43. Peng, H., Cheng, H.Y., Chen, C., Yu, W., Yang, N., Gao, W. & Ma, H., 2009. A NAC transcription factor gene of chickpea (Cicer arietinum ), CarNAC3, is involved in drought stress response and various developmental processes. Journal of plant Physiology, 166(17), 1934-1945.
  44. Qin, X. Q. & Zeevaart, J. A. D. (1999). The 9-cis-epoxycarotenoid cleavage reaction is the key regulatory step of abscisic acid biosynthesis in water stressed bean. Natl. Acad. Science U.S.A, 96, 15354–15361.
  45. Qin, X. & Zeevaart, J. A. (2002). Overexpression of a 9-cis-epoxycarotenoid dioxygenase gene in Nicotiana plumbaginifolia increases abscisic acid and phaseic acid levels and enhances drought tolerance. Plant Physiology, 128, 544–551.
  46. Raison, J. K., Berry, G. A., Armond, R. A. & Pike, C. K. (1980). Membrane properties in relation to the adaptation of plants to temperature stress. In: Turner, N.C. and P.J. and Kramer. Adaptation of plants to water and high temperature stress. John Wirly and Sons, 261-273.
  47. Recchia, H. G., Caldas, D. G. G., Beraldo, A. L. A., Silva, M. J. d. & Tsai, S. M. (2013). Transcriptional analysis of drought-induced genes in the roots of a tolerant genotype of the common bean (Phaseolus vulgaris). International Journal of Molecular Sciences, 14, 7155-7179.
  48. Saijo, Y., Hata, S., Kyozuka, J., Shimamoto, K. & Izui, K. (2000). Overexpression of a single Ca2+-dependent protein kinase confers both cold and salt/drought tolerance on rice plants. The Plant Journal, 23, 319–327.
  49. Sairam, R. K., Rao, K. V. & Srivastava, G. C. (2002). Differential response of wheat genotypes to long term salinity stress in relation to oxidative stress, antioxidant activity and osmolyte concentration. Plant Science, 163, 1037-1046.
  50. Salehpour, M., Ebadi, A., Izadi, M. & Jamaati-e-Somarin, Sh. (2009). Evaluation of water stress and nitrogen fertilizer effects on relative water content, membrane stability index, chlorophyll and some other traits of lentils (Lens culinaris) under hydroponics conditions. Research Journal of Environmental Sciences, 3, 103-109.
  51. Schwartz, S. H., Qin, X. & Zeevaart, J. A. D. (2003). Elucidation of the Indirect Pathway of Abscisic Acid Biosynthesis by Mutants, Genes, and Enzymes. Plant Physiology, 131, 1591–1601.
  52. Seo, M., Peeters, A. J. M., Koiwai, H., Oritani, T., Marion-Poll, A., Zeevaart, J. A. D., Koornneef, M., Kamiya, Y. & Koshiba, T. (2000). The Arabidopsis aldehyde oxidase 3 (AAO3) gene product catalyzes the final step in abscisic acid biosynthesis in leaves. Search ResultsProceedings of The National Academy of Sciences, U.S.A, 97, 12908–12913.
  53. Serrano, R., Gaxiola, R., Ríos, G., Forment, J., Vicente, O. & Ros, R. (2003) .Salt stress proteins indentified by a functional approach in yeast. Monatshefte für Chemie,134, 1445–1464.
  54. Sinclair, T. & Ludlow, M. (1985). Who taught plants thermodynamics? The unfulfilled potential of plant water potential. Australian Journal of Plant Physiology, 12, 213-217.
  55. Singh, S. P. (2007). Drought resistant in race Durango dry bean landraces and cultivars. Journal of Agronomy, 99, 1219-1225.
  56. Singh, B. R & Singh, B. P. (1995). Agronomic and physiological responses of sorghum, maize and pearl millet to irrigation. Field Crop Research, 42, 57-67.
  57. Spaeth, S. C., Randau, H. C. Sinclair, T. R. & Vendeland, J. S. (1984). Stability of soybean harvest index. Agronomy Journal, 76, 482-486.
  58. Tran, L. S., Nishiyama, R., Yamaguchi-Shinozaki, K. & Shinozaki, K. (2010). Potential utilization of NAC transcription factors to enhance abiotic stress tolerance in plants by biotechnological approach. GM Crops, 1, 32–39.
  59. Turkan, I., Melike, B., Ozdemir, F. & Koca, H. (2005). Differential response of lipid peroxidation and antioxidants in the leaves of drought-tolerant P. acutifolius gray and drought-sensitive vulgaris L. subjected to polyethylene glycol mediated water stress. Plant Science, 168, 223-231.
  60. Verslues, P. E., Agarwal, M., Katiyar-Agarwal, S., Zhu, J. H. & Zhu, J. K. (2006). Methods and concepts in quantifying resistance to drought, salt and freezing, abiotic stresses that affect plant water status. Plant Journal, 45, 523–539.
  61. Vivek, P. J., Tuteja, N. & Soniya, E. V. (2013). CDPK1 from ginger promotes salinity and drought stress tolerance without yield penalty by improving growth and photosynthesis in nicotiana tabacum. PLoS ONE, 8(10), e76392.
  62. Wan, B., Lin, Y. & Mou, T. (2007). Expression of rice Ca (2+)-dependent protein kinases (CDPKs) genes under different environmental stresses. FEBS Letters, 581, 1179-1189.
  63. Xiong, L., Schumaker, K. S. & Zhu, J. K. (2002). Cell signaling during cold, drought, and salt stress. Plant Cell, 165–183.
  64. Xiong, L. & Zhu, J. K. (2002) .Molecular and genetic aspects of plant responses to osmotic stress. Plant Cell Environ, 25, 131–139.
  65. Xiong, L. & Zhu, J. (2003). Regulation of abscisic acid biosynthesis. Plant Physiology, 133, 29–36.
  66. Yamada, S., Katsuhara, M., Kelly, W. B., Michalowski, C. B. & Bohnert, H. J. (1995). A family of transcripts encoding water channel proteins: Tissue-specific expression in the common ice plant. Plant Cell, 7, 1129–1142.
  67. Yamaguchi-Shinozaki, K., Koizumi, M., Urao, S. & Shinozaki, K. (1992). Molecular cloning and characterization of 9 cDNAs for genes that are responsive to desiccation in Arabidopsis thaliana: Sequenceanalysis of one cDNA clone that encodes a putative transmembrane channel protein. Plant Cell Physiology, 33, 217–224.
  68. Yang, Z-B., Eticha, D., Albacete, A., Rao, M. I., Roitsch, T. & Horst, W. J. (2012). Physiological and molecular analysis of the interaction between aluminium toxicity and drought stress in common bean (Phaseolus vulgaris). Journal of Experimental Botany, 63, 3109–3125.
  69. Yang, J. & Guo, Z. (2007). Cloning of a 9- cis-epoxycarotenoid Dioxygenase Gene (SgNCED1) from Stylosanthes guianensis and Its Expression in Response to Abiotic Stresses. Plant Cell Reports, 26, 1383–1390.
  70. Yoon, G. M., Cho, H. S., Ha, H. J., Liu, J. R. & Lee, H. S. (1999). Characterization of NtCDPK1, a calcium-dependent protein kinase gene in Nicotianatabacum, and the activity of its encoded protein. Plant Molecular Biology, 39, 991-1001. 
  71. Yu, Q., Hu, Y., Li, J., Wu, Q. & Lin, Z. (2005). Sense and antisense expression of plasma membrane aquaporin from Brassica napus in tobacco and its effects on plant drought resistance. Plant Science, 169, 647–656.
  72. Zadehbagheri, M., Kamelmanesh, M. M., Javanmardi, S. & Sharafzadeh, S. (2012). Effect of drought stress on yield and yield components, relative leaf water content, proline and potassium ion accumulation in different white bean (Phaseolus vulgaris L) genotypes. African Journal of Agricultural Research, 7(4), 5661-5670.
  73. Zhang, Y., Yang, J., Lu, S., Cai, J. & Guo, Z. (2008). Overexpressing SgNCED1 in Tobacco Increases ABA Level, Antioxidant Enzyme Activities and Stress Tolerance. Plant Growth Regulaturs, 27, 151–158.
  74. Zheng, X., Chen, B., Lu, G. & Han, B. (2009). Overexpression of a NAC transcription factor enhances rice drought and salt tolerance. Biochemical and Biophysical Research Communications, 379, 985-989.
  75. Zhu, J. K. (2002). Salt and drought stress signal transduction in plants. Annual Reviewof Plant Physiology and Plant Molecular Biology, 53, 247–273.
  1. REFERENCES

    1. Aharon, R., Shahak, Y., Wininger, S., Bendov, R., Kapulnik, Y. & Galili, G. (2003). Overexpression of a plasma membrane aquaporin in transgenic tobacco improves plant vigor under favorable growth conditions but not under drought or salt stress. Plant Cell, 15, 439–447.
    2. Akibode, S. & Maredia, M. (2011). Global and regional trends in production, trade and consumption of food legume crops. Department of Agricultural, Food and Resource Economics, Michigan State University, 87p.
    3. Anjum, S. A., Xie, X., Wang, L., Saleem, M. F., Man, C. & Lei, W. (2011). Morphological, physiological and biochemical responses of plants to drought stress. African Journal Agriculture Research, 6, 2026-2032.
    4. Aroca, R., Ferrante, A., Vernieri, P. & Vernieri, P. (2006). Drought, abscisic acid and transpiration rate effects on the regulation of PIP aquaporin gene expression and abundance in Phaseolus vulgaris Annals of Botany, 98, 1301–1310.
    5. Asfaw, A. & Blair, M. W. (2012). Quantitative trait loci for rooting pattern traits of common beans grown under drought stress versus non-stress conditions. Molecular Breed, 30, 681-695.
    6. Audran, C., Borel, C., Frey, A., Sotta, B., Meyer, C., Simonneau, T. & Marion- Poll, A. (1998). Expression studies of the zeaxanthin epoxidase gene in Nicotiana plumbaginfolia. Plant Physiology, 118, 1021–1028.
    7. Baker, N. R. & Rosenqvist, E. (2004). Applications of chlorophyll fluorescence can improve crop production strategies: an examination of future possibilities. Journal of Experimental Botany, 55, 1607-1621.
    8. Bates, L. S., Waldren, R. P. & Teare, L. D. (1973). Rapid determination of free proline for water stress studies. Journal of Plant and Soil, 39, 205-208.
    9. Bayoumi, T. Y., Manal, H. & Metwali, E. (2008). Application of physiological and biochemical indices as a screening technique for drought tolerance in wheat genotypes. African Journal Biotechnol, 14, 2341-2352.
    10. Bhattacharjee, S. & Mukherjee, A. K. (2002). Salt stress induced cytosolute accumulation, antioxidant response and membrane deterioration in three rice cultivars during early germination. Seed Science and Technology, 30, 279-287.
    11. Bohnert, H. J. & Jensen, R. G. (1996). Strategies for engineering water stress tolerance in plants. Trends in Biotechnology, 14, 89–97.
    12. Bitter, F., Oreb, M. & Mendel, R. R. (2001). ABA3 is a molybdenum cofactor sulfurase required for activation of aldehyde oxidase and xanthin dehydrogenase in Arabidopsis thaliana. Journal Biology Chemistry, 276, 40381– 40384.
    13. Broujerdnia, M., Bihamta, M. R., Alamisaeid, K. & Abdusi, V. (2016). Effect of drought stress on proline content, soluble carbohydrates, electrolyte leakage and relative water content of bean (Phaseolus vulgaris). Crop Physiology Islamic Azad University of Ahvaz, 29, 23-41. (In Persian)
    14. Cheng, W. H., Endo, A., Zhou, L., Penney, J., Chen, H. C., Arroyo, A., Leon, P., Nambara, E., Asami, T., Seo, M., Koshiba, T. & Sheen, J. (2002). A unique short-chain dehydrogenase/reductase in Arabidopsis glucose signaling and abscisic acid biosynthesis and functions. Plant Cell, 14, 2723–2743.
    15. Christianson, J. A., Dennis, E. S., Llewellyn, D. J. & Wilson, I. W. (2010). ATAF NAC transcription factors: regulators of plants tresssignaling. Plant Signal Behavior. 5,428–432.
    16. Darvish balochi, M., Paknejad, F. & Ardekani, M. (2011). Effect of drought stress and some micronutrients, foliar nutrition on chlorophyll fluorescence parameters, relative water content, membrane stability and grain yield. Journal of Field Crop Science, 41, 531-543. (In Persian)
    17. FAO Statistical Yearbook. (2013). World Food and Agriculture.
    18. Forrest, K. L. & Bhave, M. (2007). Major intrinsic proteins (MIPs) in plants: A complex gene family with major impacts on plant phenotype. Function Integration Genomics, 7, 263–289.
    19. Geravandi, M., Farshadfar, E. & Kahrizi, D. (2011). Evaluation of some physiological traits as indicators of drought tolerance in bread wheat genotypes. Russian Journal of Plant Physiology, 58(1), 69-75.
    20. Gunes, A., Inal, A., Alpuslan, M., Fraslan, F., Guneri, E. & Cicek, N. (2007). Salicylic acid induced changes on some physiological parameters symptomatic for oxidative stress and mineral nutrition in maize grown under salinity. Journal of Plant Physiology, 164, 728-736.
    21. Gunes, A., Inal., A., Adak, M. S., Bagci, E. G., Cicek, N. & Eraslan, F. (2008). Effect of drought stress implemented at pre-or post-anthesis stage on some physiological parameters as screening criteria in chickpea cultivars. Russian Journal of Plant Physiology, 55 (1), 59-67.
    22. Heath, R. & Packer, L. (1968). Photoperoxidation in isolated chloroplasts. I. Kinetics and stoichiometry of fatty acid peroxidation. Biochem. Biophys, 125, 189-198.
    23. Hu, H., Dai, M., Yao, J., Xiao, B., Li, X., Zhang, Q. & Xiong, L. (2006). Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances drought resistance and salt tolerance in rice. Proceedings of the National Academy of Sciences, 103, 12987-12992.
    24. Iuchi, S., Kobayashi, M., Taji, T., Naramoto, M., Seki, M., Kato, T., Tabata, S., Kakubari, Y., Yamaguchi-Shinozaki, K. & Shinozaki, K. (2001). Regulation of drought tolerance by gene manipulation of 9-cisepoxycarotenoid dioxygenase, a key enzyme in abscisic acid biosynthesis in Arabidopsis. The Plant Journal, 27, 325–333.
    25. Khodambashi, M., Shiran, B. & Gharaghanipour, N. (2013). Differential expression of CA7 and NCED Genes in common bean genotypes under drought stress. Journal of Agricultural Science and Technology, 15, 1491-1499.
    26. Kocheva, K. & Georgive, G. (2003). Evaluation of the reaction of two contrasting Barley (Hordeum vulgare ) Cultivars in response to osmotic stress with Peg 6000. Journal Plant Physiology, 3, 290-294.
    27. Korir, P. C., Nyabundi, J. O. & Kimurto, P. K. (2006). Genotypic responses of common bean (Phaseolus vulgaris ) to moisture stress conditions in Kenya. Asian Journal of Plant Science, 5, 24-32.
    28. Lawlor, D. W. & Cornic, G. (2002). Photosynthetic carbon assimilation and associated metabolism in relation to water deficits in higher plants. Plant Cell and Environment, 25, 275-294.
    29. Lee, S. H., Chung, G. C., Jang, J. Y., Ahn, S. J. & Zwiazek, J. J. (2012) Overexpression of PIP2; 5 aquaporin alleviates effects of low root temperature on cell hydraulic conductivity and growth in Arabidopsis. Plant Physiology 159:479-488.
    30. Lian, H. L., Yu, X., Ye, Q., Ding, X. S., Kitagawa, Y. & Kwak, S. S. (2004). The role of aquaporin RWC3 in drought avoidance in rice. Plant and Cell Physiology, 45, 481–489.
    31. Liang, Y., Q. Chen, W. Liu, Z. Zhang & Ding, R. (2003). Exogenous silicone (Si) increases antioxidant enzyme activity and reduces lipid per oxidation in roots or salt- stressed barley (Hordeum Vulgare ). Journal Plant Physiology, 99, 872-878.
    32. Liu, G., Chen, J. & Wang, X. (2006). VfCPK1, a gene encoding calciumdependent protein kinase from Vicia faba, is induced by drought and abscisic acid. Plant Cell Environ, 29, 2091-2099.
    33. Lizana, C., Wentworth, M., Martinez, J. P., Villegas, D., Meneses, R., Murchie, E. H., Pastenes, C., Lercari, B., Vernieri, P., Horton, P. & Pinto, M. (2006). Differential adaptation of two varieties of common bean to abiotic stress. I. Effect of drought on yield and photosynthesis. Journal of Experimental Botany, 57, 685-697.
    34. Luan, S. (2002). Signalling drought in guard cells. Plant Cell Environ, 25, 229–237.
    35. Ma, S. Y. & Wu, W. H. (2007). AtCPK23 functions in Arabidopsisresponses to drought and salt stresses. Plant Molecular Biology, 65: 511-518.
    36. Mahajan, S. & Tuteja, N. (2005). Cold, salinity and drought stresses: an Archive Biochem Biophys, 444, 139-158.
    37. Martınez, J. P., Silva, H., Ledent, J. F. & Pinto, M. (2007). Effect of drought stress on theosmotic adjustment, cell wall elasticity and cell volume of six cultivars of common beans (Phaseolus vulgaris). Europ Journal Agronomy, 26, 30-38.
    38. Mudgal, V., Madaan, N. & Mudgal, A. (2010). Biochemical mechanisms of salt tolerance in plants: A review. International Journal of Botany, 6, 136-143.
    39. Nakashima, K., Tran, L-SP., Nguyen, D. V., Fujita, M., Maruyama, K., Todaka, D., Ito, Y., Hayashi, N., Shinozaki, K. & Yamaguchi-Shinozaki, K. (2007). Functional analysis of a NAC-type transcription factor OsNAC6 involved in abiotic and biotic stress-responsive gene expression in rice. The Plant Journal, 51, 617-630.
    40. Nakashima, K., Takasaki, H., Mizoi, J., Shinozaki, K. & Yamaguchi-Shinozaki, K. (2012). NAC transcription factors in plant abiotic stress responses. Biochim Biophys Acta, 1819, 97–103.
    41. Nambara, E. & Marion-Poll, A. (2005). Abscisic acid biosynthesis and catabolism. Annals Reiew of Plant Biology, 56, 165–185.
    42. Olsen, A. N., Ernst, H. A., Leggio, L. L. & Skriver, K. (2005). NAC transcription factors: structurally distinct, functionally diverse. Trends Plant Science, 10, 79–87.
    43. Peng, H., Cheng, H.Y., Chen, C., Yu, W., Yang, N., Gao, W. & Ma, H., 2009. A NAC transcription factor gene of chickpea (Cicer arietinum ), CarNAC3, is involved in drought stress response and various developmental processes. Journal of plant Physiology, 166(17), 1934-1945.
    44. Qin, X. Q. & Zeevaart, J. A. D. (1999). The 9-cis-epoxycarotenoid cleavage reaction is the key regulatory step of abscisic acid biosynthesis in water stressed bean. Natl. Acad. Science U.S.A, 96, 15354–15361.
    45. Qin, X. & Zeevaart, J. A. (2002). Overexpression of a 9-cis-epoxycarotenoid dioxygenase gene in Nicotiana plumbaginifolia increases abscisic acid and phaseic acid levels and enhances drought tolerance. Plant Physiology, 128, 544–551.
    46. Raison, J. K., Berry, G. A., Armond, R. A. & Pike, C. K. (1980). Membrane properties in relation to the adaptation of plants to temperature stress. In: Turner, N.C. and P.J. and Kramer. Adaptation of plants to water and high temperature stress. John Wirly and Sons, 261-273.
    47. Recchia, H. G., Caldas, D. G. G., Beraldo, A. L. A., Silva, M. J. d. & Tsai, S. M. (2013). Transcriptional analysis of drought-induced genes in the roots of a tolerant genotype of the common bean (Phaseolus vulgaris). International Journal of Molecular Sciences, 14, 7155-7179.
    48. Saijo, Y., Hata, S., Kyozuka, J., Shimamoto, K. & Izui, K. (2000). Overexpression of a single Ca2+-dependent protein kinase confers both cold and salt/drought tolerance on rice plants. The Plant Journal, 23, 319–327.
    49. Sairam, R. K., Rao, K. V. & Srivastava, G. C. (2002). Differential response of wheat genotypes to long term salinity stress in relation to oxidative stress, antioxidant activity and osmolyte concentration. Plant Science, 163, 1037-1046.
    50. Salehpour, M., Ebadi, A., Izadi, M. & Jamaati-e-Somarin, Sh. (2009). Evaluation of water stress and nitrogen fertilizer effects on relative water content, membrane stability index, chlorophyll and some other traits of lentils (Lens culinaris) under hydroponics conditions. Research Journal of Environmental Sciences, 3, 103-109.
    51. Schwartz, S. H., Qin, X. & Zeevaart, J. A. D. (2003). Elucidation of the Indirect Pathway of Abscisic Acid Biosynthesis by Mutants, Genes, and Enzymes. Plant Physiology, 131, 1591–1601.
    52. Seo, M., Peeters, A. J. M., Koiwai, H., Oritani, T., Marion-Poll, A., Zeevaart, J. A. D., Koornneef, M., Kamiya, Y. & Koshiba, T. (2000). The Arabidopsis aldehyde oxidase 3 (AAO3) gene product catalyzes the final step in abscisic acid biosynthesis in leaves. Search ResultsProceedings of The National Academy of Sciences, U.S.A, 97, 12908–12913.
    53. Serrano, R., Gaxiola, R., Ríos, G., Forment, J., Vicente, O. & Ros, R. (2003) .Salt stress proteins indentified by a functional approach in yeast. Monatshefte für Chemie,134, 1445–1464.
    54. Sinclair, T. & Ludlow, M. (1985). Who taught plants thermodynamics? The unfulfilled potential of plant water potential. Australian Journal of Plant Physiology, 12, 213-217.
    55. Singh, S. P. (2007). Drought resistant in race Durango dry bean landraces and cultivars. Journal of Agronomy, 99, 1219-1225.
    56. Singh, B. R & Singh, B. P. (1995). Agronomic and physiological responses of sorghum, maize and pearl millet to irrigation. Field Crop Research, 42, 57-67.
    57. Spaeth, S. C., Randau, H. C. Sinclair, T. R. & Vendeland, J. S. (1984). Stability of soybean harvest index. Agronomy Journal, 76, 482-486.
    58. Tran, L. S., Nishiyama, R., Yamaguchi-Shinozaki, K. & Shinozaki, K. (2010). Potential utilization of NAC transcription factors to enhance abiotic stress tolerance in plants by biotechnological approach. GM Crops, 1, 32–39.
    59. Turkan, I., Melike, B., Ozdemir, F. & Koca, H. (2005). Differential response of lipid peroxidation and antioxidants in the leaves of drought-tolerant P. acutifolius gray and drought-sensitive vulgaris L. subjected to polyethylene glycol mediated water stress. Plant Science, 168, 223-231.
    60. Verslues, P. E., Agarwal, M., Katiyar-Agarwal, S., Zhu, J. H. & Zhu, J. K. (2006). Methods and concepts in quantifying resistance to drought, salt and freezing, abiotic stresses that affect plant water status. Plant Journal, 45, 523–539.
    61. Vivek, P. J., Tuteja, N. & Soniya, E. V. (2013). CDPK1 from ginger promotes salinity and drought stress tolerance without yield penalty by improving growth and photosynthesis in nicotiana tabacum. PLoS ONE, 8(10), e76392.
    62. Wan, B., Lin, Y. & Mou, T. (2007). Expression of rice Ca (2+)-dependent protein kinases (CDPKs) genes under different environmental stresses. FEBS Letters, 581, 1179-1189.
    63. Xiong, L., Schumaker, K. S. & Zhu, J. K. (2002). Cell signaling during cold, drought, and salt stress. Plant Cell, 165–183.
    64. Xiong, L. & Zhu, J. K. (2002) .Molecular and genetic aspects of plant responses to osmotic stress. Plant Cell Environ, 25, 131–139.
    65. Xiong, L. & Zhu, J. (2003). Regulation of abscisic acid biosynthesis. Plant Physiology, 133, 29–36.
    66. Yamada, S., Katsuhara, M., Kelly, W. B., Michalowski, C. B. & Bohnert, H. J. (1995). A family of transcripts encoding water channel proteins: Tissue-specific expression in the common ice plant. Plant Cell, 7, 1129–1142.
    67. Yamaguchi-Shinozaki, K., Koizumi, M., Urao, S. & Shinozaki, K. (1992). Molecular cloning and characterization of 9 cDNAs for genes that are responsive to desiccation in Arabidopsis thaliana: Sequenceanalysis of one cDNA clone that encodes a putative transmembrane channel protein. Plant Cell Physiology, 33, 217–224.
    68. Yang, Z-B., Eticha, D., Albacete, A., Rao, M. I., Roitsch, T. & Horst, W. J. (2012). Physiological and molecular analysis of the interaction between aluminium toxicity and drought stress in common bean (Phaseolus vulgaris). Journal of Experimental Botany, 63, 3109–3125.
    69. Yang, J. & Guo, Z. (2007). Cloning of a 9- cis-epoxycarotenoid Dioxygenase Gene (SgNCED1) from Stylosanthes guianensis and Its Expression in Response to Abiotic Stresses. Plant Cell Reports, 26, 1383–1390.
    70. Yoon, G. M., Cho, H. S., Ha, H. J., Liu, J. R. & Lee, H. S. (1999). Characterization of NtCDPK1, a calcium-dependent protein kinase gene in Nicotianatabacum, and the activity of its encoded protein. Plant Molecular Biology, 39, 991-1001. 
    71. Yu, Q., Hu, Y., Li, J., Wu, Q. & Lin, Z. (2005). Sense and antisense expression of plasma membrane aquaporin from Brassica napus in tobacco and its effects on plant drought resistance. Plant Science, 169, 647–656.
    72. Zadehbagheri, M., Kamelmanesh, M. M., Javanmardi, S. & Sharafzadeh, S. (2012). Effect of drought stress on yield and yield components, relative leaf water content, proline and potassium ion accumulation in different white bean (Phaseolus vulgaris L) genotypes. African Journal of Agricultural Research, 7(4), 5661-5670.
    73. Zhang, Y., Yang, J., Lu, S., Cai, J. & Guo, Z. (2008). Overexpressing SgNCED1 in Tobacco Increases ABA Level, Antioxidant Enzyme Activities and Stress Tolerance. Plant Growth Regulaturs, 27, 151–158.
    74. Zheng, X., Chen, B., Lu, G. & Han, B. (2009). Overexpression of a NAC transcription factor enhances rice drought and salt tolerance. Biochemical and Biophysical Research Communications, 379, 985-989.
    75. Zhu, J. K. (2002). Salt and drought stress signal transduction in plants. Annual Reviewof Plant Physiology and Plant Molecular Biology, 53, 247–273.
دوره 52، شماره 4
زمستان 1400
صفحه 1-14

  • تاریخ دریافت 07 اردیبهشت 1398
  • تاریخ بازنگری 16 آذر 1398
  • تاریخ پذیرش 18 دی 1398
  • تاریخ انتشار 01 دی 1400