بررسی اثر 24- اپی براسینواستروئید بر بیان برخی از ژن‌های درگیر در مسیر بیوسنتز دایوسجنین در شنبلیله (Trigonella foenum-graecum L.)تحت تنش دمای بالا

نوع مقاله : مقاله پژوهشی

نویسندگان

1 دانشجوی سابق کارشناسی ارشد گروه زراعت و اصلاح نباتات، دانشکده کشاورزی، دانشگاه صنعتی شاهرود

2 استادیار، گروه زراعت و اصلاح نباتات، دانشکده کشاورزی، دانشگاه صنعتی شاهرود

3 دانشیار، گروه زراعت و اصلاح نباتات، دانشکده کشاورزی، دانشگاه صنعتی شاهرود

4 استادیار، گروه بیوتکنولوژی، دانشکده کشاورزی، دانشگاه تربیت مدرس

چکیده

استفاده از تحریک­کننده­های مختلف از قبیل تنش­های غیرزنده، تشعشعات و تنظیم­کننده­های رشد مختلف به­منظور افزایش کمیت متابولیت­های ثانویه، یکی از زمینه­های تحقیقاتی جالب توجه به­شمار می­رود. این تحقیق با هدف بررسی اثر 24-اپی­­براسینواستروئید بر تغییرات بیان برخی از ژن­های دخیل در مسیر بیوسنتز دایوسجنین در شنبلیله تحت تنش دمای بالا، به‌صورت فاکتوریل و در قالب طرح کاملا تصافی انجام شد. نتایج نشان داد که بیشترین میزان بیان ژن (Cycloartenol synthase) CAS در تیمار دمای بالا و سطح دو ppm از هورمون 24- اپی­براسینواستروئید در زمان 24 ساعت پس از تنش (27 برابر) به‌دست آمد. همچنین بیشترین میزان بیان ژن SSR در تیمار دمای نرمال و سطح پنج ppm  در زمان 24 ساعت به میزان 5/3 برابر مشاهده شد. کاربرد سطوح دو و پنج ppm  از هورمون 24-اپی­براسینواستروئید در زمان اعمال تنش دمای بالا، به­صورت معنی‌داری منجر به افزایش بیان ژنSSR  شد. بیان ژنSEP (Squalene epoxidase)  نسبت به شرایط دمای نرمال در سطوح دو و پنج ppm، به‌ترتیب 20 و 10 برابر افزایش یافت. کاربرد 24-اپی­براسینواستروئید بعد از گذشت 24 ساعت، موجب افزایش بسیار معنی‌دار بیان ژن(Sterol methyltransferase)  SMT به میزان شش برابر (نسبت به دمای 23 درجه سانتی­گراد و عدم کاربرد 24-اپی­­براسینواستروئید) شد. بیان ژن (Squalene synthase) SQS با اعمال تیمار دمای بالا و سطوح مختلف 24-اپی­براسینواستروئید نسبت به شرایط نرمال کاهش یافت. نتایج نشان داد که می­توان از 24-اپی­براسینواستروئید و تنش دمای بالا، به­عنوان یک محرک مناسب به­منظور افزایش بیان برخی ژن­های درگیر در مسیر بیوسنتز دایوسجنین و افزایش محتوی دایوسجنین استفاده کرد.

کلیدواژه‌ها


عنوان مقاله [English]

The effect of 24-epi-brassinosteroid on the expression of some genes involved in the diosgenin biosynthetic pathway of fenugreek (Trigonella foenum-graecum L.) under high temperature stress

نویسندگان [English]

  • Shahlla sheikhi 1
  • Amin Ebrahimi 2
  • Parviz Heidari 2
  • Mohamad Reza Amerian 3
  • Sajad Rashidi Monfared 4
1 Department of Agriculture and Plant Breeding, Faculty of Agriculture, Shahrood University of Technology
2 Department of Agriculture and Plant Breeding, Faculty of Agriculture, Shahrood University of Technology
3 Department of Agriculture and Plant Breeding, Faculty of Agriculture, Shahrood University of Technology
4 Department of Biotechnology, Faculty of Agriculture, Tarbiat Modares University
چکیده [English]

The application of various stimulants, such as abiotic stress, radiation, and growth regulators to increase the quantity of secondary metabolites is one of the interesting research areas. The aim of this study was to investigate the effect of 24-epi-brassinosteroid on the expression of some genes involved in the diosgenin biosynthetic pathway of fenugreek under high temperature stress. The highest expression of cycloartenol synthase (27-fold) was observed at high temperature treatment and 2 ppm of 24-epi-brassinosteroid (at 24 h after heat stress), while the highest expression of SSR gene was 3.5 fold at normal temperature and 5 ppm 24-epi-brassinosteroid. Application of 2 and 5 ppm of 24-epi-brassinosteroid significantly increased squalene epoxidase expression during high temperature stress. Compared to normal condition, squalene epoxidase expression increased 20 and 10 fold at 2 and 5 ppm of 24-epi-brassinosteroid, respectively. Application of 24-epi-brassinosteroid (2 ppm) after 24 hours significantly increased the expression of sterol methyltransferase by 6-fold (Compared to 23°C and non-application of 24-epi-brassinosteroid). Interestingly, compared to normal condition, squalene synthase expression was decreased at high temperature treatment and different levels of 24-epi-brassinosteroid. The results showed that 24-epi-brassinosteroid (2 and 5 ppm) could be used as a suitable stimulus to enhance the expression of some genes involved in the biosynthesis pathway and subsequently to increase the content of the diosgenin.

کلیدواژه‌ها [English]

  • abiotic stress
  • diosgenin
  • Fenugreek
  • gene expression
  • secondary metabolites

مقدمه

شنبلیله گیاهی علفی ‌و یک‌ساله، متعلق به تیره بقولات[1]، راسته گلسرخ‌[2] و جنس Trigonella L می‌باشد. تاکنون 70 گونه از این جنس شناسایی شده است که شامل گیاهان یک‌ساله تا چند ساله هستند (Dini, 2006). مهم­ترین ویژگی دارویی در این گیاه، وجود مقادیر قابل توجهی دایوسجنین (Diosgenin) است که از آن برای تولید داروهای استروئیدی و هورمون‌هایی مانند تستوسترون[3]، گلوکوکورتیکوئیدها[4] و پروژسترون[5] استفاده می‌شود (Joanna et al., 2015). دایوسجنین یک ساپوژنین استروئیدی دارای خاصیت ضد کلسترولی و توموری است و برای درمان بیماری‌هایی همچون سرطان خون و روده کاربرد دارد. این ماده پیش‌ساز سنتز داروهایی مانند قرص‌های ضدبارداری، هورمون‌های جنسی و ترکیبات استروئیدی است (Ciura et al., 2017).

دایوسجنین از طریق مسیر بیوسنتز ایزوپرنوئیدها[6] تولید می­شود. این مسیر با پیش­ماده­ استیل کوآنزیم‌آ­ به ایزوپنتیل پیروفسفات[7]می­رسد.(Abbasi et al., 2011) برای تولید دایوسجنین، مسیر لانوسترول (Lanosterol) و کلسترول (Cholesterol) و مسیر سیکلوآرتنول (Cycloartenol) و حدواسط سیتواسترول (Cytosterol) پیشنهاد شده است. سیکلوآرتنول سنتاز (Cycloartenol synthase) و لانوسترول سنتاز  (Lanosterol synthase)دو آنزیم کلیدی متعلق به خانواده­ی اکسیدواسکوالن سیکلازها (Oxidosqualene cyclase) هستند و در این مسیر دخالت دارند (Chaudhary et al., 2015). شناسایی مسیر بیوسنتزی دایوسجنین و ژن­های مهم این مسیر در مهندسی این متابولیت حیاتی به­نظر می‌رسد. متاسفانه اطلاعات در مورد مسیر بیوسنتزی دایوسجنین در شنبلیله بسیار اندک می­باشد و بیشتر اطلاعات در مورد این مسیر بیوسنتزی در سایر گیاهان مانند یام (Dioscorea villosa) و خانواده سولاناسه[8] در دسترس است.

هورمون­های گیاهی[9]، نقش مهمی در تنظیم فعالیت­های گیاهی بر عهده دارند. براسینواستروئیدها[10] ششمین گروه از هورمون­های گیاهی هستند که بعد از اکسین[11]، جیبرلین[12]، سیتوکنین[13]، اتیلن[14] و آبسزیک اسید[15] در سال 1970 از دانه گرده گیاه کلزا استخراج شدند. براسینواستروئیدها در رشد گیاهان متعدد و فرآیندهای رشد همچون طویل شدن سلول، نور-ریخت­زایی (Photomorphogenesis)، کنترل زمان گل‌دهی و واکنش‌ها به تنش  نقش دارند (Anwar et al., 2018). خواب بذر یا جوانه‌زنی در گیاهان، تحت تأثیر شرایط محیطی قرار می­گیرند. جیبرلین‌ها (GAها)، براسینوستروئیدها (BRها)، اسید آبسزیک (ABA)، سیتوکینین (CK)، اتیلن، اسید سالیسیلیک (SA) برای رشد و جوانه زنی گیاهان ضروری هستند (Jager et al., 2008).

در یک تحقیق، برخی از ژن­های مسیر بیوسنتز دایوسجنین با روش طراحی آغازگرهای دژنره[16] شناسایی و جداسازی شدند و رابطه بین میزان بیان این ژن­ها و محتوی دایوسجنین (با استفاده از HPLC[17]) در نه توده شنبلیله با محتوی دایوسجنین متفاوت بررسی شد (Mohammadi et al., 2019). در یک پژوهش، تغییرات محتوی دایوسجنین در گیاهچه­های شش توده شنبلیله تحت تیمار جاسمونیک اسید بررسی شد. نتایج این پژوهش نشان داد که سطوح مختلف جاسمونیک اسید، منجر به تغییر در میزان بیان ژن­های (3-hydroxy-3-methylglutaryl-CoA reductase) HMG و  (Sterol-3-β-glucosyl transferase) STRL به­ترتیب به میزان 2/3 و 2/22 برابر می‌شود. همچنین نتایج آن­ها نشان داد که جاسمونیک اسید می­تواند به­عنوان یک محرک مناسب در افزایش کمیت دایوسجنین در شنبلیله موثر باشد (Chaudhary et al., 2015). اثر کاربرد اتیلن بر خصوصیات فیزیولوژیکی، بیان برخی ژن­های مسیر دایوسجنین و همچنین محتوی آن بررسی شد. در این تحقیق، از چهار غلظت مختلف اتفن[18] (1-10تا 4-10) استفاده شد و نتایج  نشان داد که غلظت­های بالای اتفن، مانع از رشد گیاه یام
(Dioscorea zingiberensis) می‌شود، درحالی‌که غلظت­های پایین، تحریک­کننده رشد بودند. محتوی دایوسجنین در غلظت 3-10 اتفن، به­صورت معنی­داری افزایش یافت. همچنین محتوی پروتئین کل و کلروفیل به‌ترتیب در غلظت­های 2-10 و 3-10 به‌صورت معنی­داری نسبت به شاهد افزایش یافتند.  کاربرد اتفن نیز منجر به افزایش بیان ژن SQS و کاهش بیان CAS شد (Diarra et al., 2013).

بیشتر متابولیت­ها از گیاهان استخراج می­شوند و ارزش متابولیت­های ثانویه در درمان بیماری­ها غیر قابل انکار است. دایوسجنین عموما از غده­های گیاه یام استخراج می­شود؛ اگرچه استخراج آن از ریشه گیاه یام به علت بالا بودن نشاسته، دشوار و گرانقیمت است. طول مدت رشد این گیاه دو سال است (Diarra et al., 2013)، درحالی‌که این متابولیت در گیاه شنبلیله نیز به‌ فراوانی یافت می‌شود. با افزایش این متابولیت در شنبلیله، این گیاه می­تواند جایگزینی برای گیاه یام باشد، چرا که طول دوره­ رشد آن دو الی سه ماه است و با اکثر اقلیم­ها نیز سازگار است (Acharya et al., 2008). گیاهان مخصوصا گیاهان دارویی، با انتقال از محیط زندگی خود (محیط بومی) به محیط زراعی، تحت تاثیر قرار می­گیرند و میزان متابولیت ثانویه در آن­ها کاهش می‌یابد (Tetenyi, 2002; Gorelick and Bernstein, 2014).

شنبلیله دارای طبیعت گرم و خشک است و به­علت زمستانه بودن، نسبت به دماهای پایین مقاوم است، اما در طول رویش، به هوای نسبتا گرم نیاز دارد؛ اگرچه وقوع دماهای بالا (بالاتر از 35 درجه سانتیگراد)
(Pant et al., 2013; Osman et al., 2015) به این گیاه آسیب می­رساند (Helambe and Dandeh, 2012). دمای هوای کره زمین در چند دهه اخیر در حال افزایش است و این افزایش دما در حال تبدیل شدن به یک مشکل جهانی می­باشد، چرا که گیاهان و عملکرد آن­ها را تحت تاثیر قرار می­دهد
 (Lamaouie et al., 2018). با توجه به اهمیت دایوسجنین در شنبلیله به­عنوان یک متابولیت ارزشمند، استفاده از محرک‌های مختلف به­منظور افزایش بیان ژن‌های مسیر بیوسنتز دایوسجنین و متعاقبا محتوی دایوسجنین ضروری به­نظر می‌رسد. بنابراین، این تحقیق با هدف بررسی آثار تنش دمای بالا و هورمون 24-اپی­براسینواستروئید (به­عنوان دو محرک افزایش بیوسنتز دایوسجنین) بر بیان برخی از ژن­های مسیر بیوسنتز دایوسجنین انجام شد. نتایج تحقیق حاضر می­تواند در مهندسی مسیر بیوسنتز دایوسجنین مفید واقع شود.

 

مواد و روش­ها

شرایط کشت و اعمال تیمار

این آزمایش، به­صورت فاکتوریل و در قالب طرح کاملا تصادفی با سه تکرار در دانشگاه صنعتی شاهرود انجام شد. تیمارهای این آزمایش شامل هورمون 24-­اپی­براسینواستروئید در چهار سطح (صفر، دو، پنج و 10 ppm) و دو شرایط دمایی 42 درجه سانتی‌گراد (تنش دمای بالا) و 23 درجه سانتی‌گراد (دمای نرمال) (Pant et al., 2013; Osman et al., 2015) و سه بازه زمانی صفر، شش و 24 ساعت پس از اعمال تنش بودند. در این آزمایش، ابتدا بذرهای گیاه شنبلیله (رقم همدان) ضدعفونی و در گلدان­های 20 سانتی­متری با ترکیب پیت ماس و پرلیت در اتاقک رشد با دمای 23 درجه سانتی‌گراد و دوره نوری 16 ساعت روشنایی و هشت ساعت تاریکی کشت شدند. گیاهان پنج هفته­ای با سه سطح هورمون 24-­اپی­براسینواستروئید اسپری­پاشی شدند. تعدادی از گلدان­ها در شرایط نرمال و تعدادی دیگر به اتاقک رشد به­منظور اعمال تنش گرمایی منتقل شدند. سپس در زمان‌های شش و 24 ساعت پس از تنش دمای بالا، از برگ­های گیاه نمونه­برداری شد و نمونه‌ها بلافاصله در فریزر 80- درجه سانتی‌گراد ذخیره شدند.

استخراج RNA

استخراج RNA با استفاده از کیت RNX Plus (شرکت سیناکلون- کد محصول RN7713C) و با توجه به دستورالعمل شرکت سازنده انجام شد. به­منظور حذف آلودگی­های DNA، یک میکروگرم از RNA استخراج شده تحت تیمار I DNAse قرار گرفت. در ضمن، کیفیت و کمیت RNA با استفاده از ژل آگارز یک درصد و دستگاه نانودراپ تعیین شد.

 ساخت cDNA

به­منظور ساخت cDNA، از آغازگر Oligo (dT) برای اتصال به دم پلی­آدنین mRNA استفاده شد. برای ساخت cDNA، از کیت HyperScript Reverse transcriptase (GeneALL) و با توجه به دستورالعمل شرکت سازنده استفاده شد.

طراحی آغازگرها

متاسفانه پیچیدگی­ها و نکات مبهم زیادی در این مسیر وجود دارد و تاکنون مطالعه کاملی بر روی ژن‌های دخیل در مسیر بیوسنتز دایوسجنین در گیاه شنبلیله انجام نشده ‌است. آغازگرها (جدول 1) با استفاده از برنامه آنلاین Primer 3 Plus طراحی شدند و به­منظور کنترل صحت آن­ها، از برنامه Analyzer v.3.1 Oligo (http://eu.idtdna.com/calc/analyzer) استفاده شد.

 

 

جدول 1- آغازگرهای مورد استفاده و مشخصات آن­ها

Table 1. Primers used in this study and their characteristics

Annealing temperature

Length (bp)

 

 

Primer Sequence (′ 3 - ′5)

Primer name

Position on the chromosome

Accession number

Reverse

Forward

 

61

152

1066-1218

MK060115.1

CATTCTGTGTGTCTCCCTGCC

AGGTGGGAGATATGCTAGAATGGG

SSR

62

140

806-946

MK060114.1

 

CACAGTAACTCATGACAACAGCAACCT

GAGAAGGCTGCAGAGGGTCTAG

SMT

60

168

1318-1486

KX14846

CAGATGCACCAGAGAGTAATCG

CTATTCTCAGAAGGACCGATCTC

SEP

60

17

2080-2259

KX148475.1

TACATGACGACGGTATTCTCCC

AAGAGAGATCCAACACCACTGC

CAS

61

133

1162-1295

KX148475.1

TACCCACTGTTCCATTGCTATCC

GGCTCAACCATGATTCTCATACTG

SQS

61

230

429-729

XM_010679634.2

 

TATGTTTGTTGTTGGTGTCAACGAGCAACGAATACAAG

ATGTTAAATGATGCAGCCCTTCCACCTCTC

GAPDH (Reference)

 

 

بررسی صحت سنتز آغازگرها و انجام واکنش  PCR زمان واقعی

به منظور اطمینان از ساخت صحیح cDNA و کارکرد آغازگرهای طراحی شده قبل از بررسی بیان ژن­های مورد نظر، ابتدا تکثیر نواحی هدف توسط PCR معمولی انجام شد. برای واکنش PCR زمان واقعی، از مستر شرکت SYBR®Green PCR Master Mix 2X (Ampliqon) استفاده شد. واکنش­ها در حجم 10 میکرولیتر و با سه تکرار زیستی و دو تکرار تکنیکی انجام شدند. به­منظور اطمینان از عدم آلودگی اجزا، از کنترل منفی استفاده شد. واکنش PCR زمان واقعی، با استفاده از دستگاه ABI Step one و مطابق با اجزا جدول 2 انجام شد. این واکنش با شرایط دمایی و زمانی 10 دقیقه در دمای 95 درجه سانتی‌گراد و 35 تکرار با چرخه‌های 15 ثانیه در دمای 95 درجه سانتی‌گراد، 40 ثانیه در دمای 60 درجه سانتی‌گراد انجام شد.

تجزیه داده­های PCR زمان واقعی

به‌منظور تجزیه داده­های  PCRزمان واقعی، بیان نسبی هر ژن بر اساس روش منحنی استاندارد نسبی[19] بر پایة فرمول 2-ΔΔCt  (Livak & Schmittgen, 2001) محاسبه شد، که مطابق آن، میزان بیان ژن (cDNA حاصل از رونوشت) برابر با دو به توان منفی تفاوت آستانه سیکل ژن هدف تحت تنش و ژن مرجع متناظر آن منهای تفاوت میانگین­های آستانه سیکل ژن هدف بدون تنش و ژن مرجع متناظر (GAPDH)  آن است. مقایسه میانگین­ها با استفاده از روش دانکن و در سطح احتمال یک درصد انجام شد.

 

 

 

جدول 2- اجزای مورد استفاده در واکنش PCR زمان واقعی

Table 2. Compounds used in real-time PCR reaction

Concentration

Volumes (µl)

Materials

-

3

Nuclease Free Water

ngµl -1 50

1

cDNA

pmolµl-1 10

0.5

Forward Primer

pmolµl-1 10

0.5

Reverse Primer

2X

5

SYBR®Green PCR Master Mix

-

10

Total

 

 

نتایج و بحث

بیان ژن (Squalene synthase) SQS

بیان ژن SQS در شرایط نرمال (دمای 23 درجه سانتی‌گراد)  و در زمان شش ساعت پس از کاربرد 24-اپی­براسینواستروئید، در هر سه سطح هورمون کاهش یافت؛ اگرچه این کاهش در سطح دو ppm معنی‌دار نبود (شکل 1، A). بیان این ژن در شرایط نرمال (دمای 23 درجه سانتی‌گراد)، در زمان 24 ساعت پس از تیمار با سطح پنج ppm هورمون 24-اپی­براسینواستروئید به­صورت معنی‌داری افزایش و در سایر سطوح کاهش یافت. بیان ژن مذکور در شرایط تنش دمای بالا کاهش یافت؛ اگرچه کاربرد سطوح مختلف 24-اپی­براسینواستروئید، منجر به افزایش بیان این ژن نسبت به شرایط دمای بالا و عدم کاربرد 24-اپی­براسینواستروئید شد. بیان ژن SQS در شرایط نرمال دمایی و 24 ساعت پس از تیمار با سطح پنج ppm  24-اپی­براسینواستروئید نسبت به شرایط نرمال دمایی و عدم کاربرد  24-اپی­براسینواستروئید 2/1 برابر افزایش یافت. بیان این ژن در شرایط دمای نرمال و 24 ساعت پس از تیمار با 24-اپی­براسینواستروئید برابر با یک بود و اختلاف معنی­داری با تیمار دمای نرمال و شش ساعت پس از تیمار 24-اپی­براسینواستروئید نداشت.

بیان ژن (Squalene epoxidase) SEP

بیان ژن SEP در شرایط نرمال (دمای 23 درجه سانتی‌گراد) بدون کاربرد و یا با کاربرد 24-اپی­براسینواستروئید در زمان‌های شش و 24 ساعت، تغییر چندانی نداشت (شکل 1، B)، درحالی‌که اعمال تنش دمای بالا در هر دو زمان شش و 24 ساعت، منجر به افزایش معنی‌دار بیان این ژن شد. در زمان اعمال تنش دمای بالا و دو ppm  24-اپی­براسینواستروئید، بیان این ژن به میزان پنج برابر نسبت به شرایط دمای نرمال (دمای 23 درجه سانتی‌گراد) افزایش یافت. کاربرد سطوح دو و پنج ppm از هورمون 24-اپی­براسینواستروئید در زمان اعمال تنش دمای بالا، به­صورت معنی‌داری منجر به افزایش بیان این ژن شد، به‌‌طوری‌که بیان این ژن در این دو تیمار  نسبت به شرایط دمای نرمال (دمای 23 درجه سانتی‌گراد و بدون کاربرد 24-اپی­براسینواستروئید)، به‌ترتیب 20 و 10 برابر افزایش یافت. همچنین بیان این ژن، شش ساعت پس از شروع دمای 42 درجه سانتی­گراد و بدون کاربرد 24-اپی­براسینواستروئید نسبت به دمای نرمال، سه برابر افزایش یافت. این در حالی­است که تیمار  دو ppm 24-اپی­براسینواستروئید، شش ساعت پس از تنش شروع تنش دمای بالا، منجر به افزایش چهار برابری این ژن نسبت به دمای تیمار دمای نرمال و عدم کاربرد 24-اپی­براسینواستروئید شد.

 

 

 

A

B

 

شکل 1-  اثرات سه‌گانه دما، زمان و غلظت­های 24- اپی­براسینواستروئید بر بیان ژن­های A)SQS  و B) SEP.. مقایسه میانگین با روش دانکن و در سطح احتمال یک درصد انجام شده است. ستون­هایی با حروف مشابه، دارای اختلاف معنی داری با یکدیگر نیستند. بیان تمامی تیمارها با توجه به فرمول 2-ΔΔCT نسبت به تیمار دمای نرمال (23 درجه سانتی­گراد و عدم کاربرد 24-اپی­براسینواستروئید) نرمال شده­اند.

Figure 2. Triple interaction effects of temperature, time and concentration of 24-epi-brossinosteroid on A) SQS and B) SEP expression (B). (Mean comparison was performed by Duncan test at 1% of probability level. Columns with similar letters are not significantly different). Expression of all treatments was normalized to normal temperature (23°C and Non-application of 24-epi-brassinosteroid) according to the formula 2-ΔΔCT.

 

 

 

بیان ژن (Cycloartenol synthase) CAS

بیان این ژن در شرایط نرمال (دمای 23 درجه سانتی‌گراد) با کاربرد 24-اپی­براسینواستروئید در زمان‌های 6 و 24 ساعت در برخی از سطوح به­صورت معنی­داری نسبت به همین تیمار دمایی و عدم کاربرد 24-اپی­براسینواستروئید افزایش یافت (شکل A2). بیان ژن CAS در شرایط دمای نرمال و در زمان شش ساعت و سطوح پنج و ppm 10 به میزان شش برابر و در زمان 24 ساعت و در سطح دو و پنجppm  نیز به میزان 10 برابر افزایش یافت. تنش دمای بالا و کاربرد 24-اپی­براسینواستروئید، بیان این ژن را نسبت به شرایط تنش دمای بالا و بدون کاربرد 24-اپی براسینواستروئید افزایش داد. بیشترین میزان بیان این ژن، در تیمار دمای بالا و سطح دو ppm از 24-اپی براسینواستروئید در زمان 24 ساعت پس از تنش (27 برابر) به‌دست آمد؛ اگرچه در همین تیمار دمایی، سایر سطوح (پنج و ppm 10) نیز به‌صورت معنی­داری منجر به افزایش بیان این ژن شدند. بیان این ژن در تیمار دمای بالا (24 ساعت) و پس از کاربرد 24-اپی­براسینواستروئید با سطوح پنج و 10 ppm نسبت دمای نرمال و عدم کاربرد 24-اپی­براسینواستروئید، به‌ترتیب 16 و 13 برابر افزایش یافت.

بیان ژن (Sterol methyltransferase) SMT

میزان بیان ژن SMT در شرایط دمایی نرمال در سطوح دو و ppm 10 کاهش و در سطح پنج ppm  نسبت به شاهد (دمای 23 درجه سانتی‌گراد و بدون کاربرد 24-اپی­براسینواستروئید) تغییری نداشت (شکل 2، B). به عبارت دیگر، کاربرد سطوح مختلف 24-اپی­براسینواستروئید، منجر به افزایش در میزان بیان این ژن نشد. بعد از گذشت 24 ساعت از زمان تنش دمای بالا (بدون تیمار با 24-اپی­براسینواستروئید)، بیان ژن مذکور به­صورت بسیار معنی‌داری افزایش یافت. بیان ژن SMT در شرایط تنش دمای بالا و زمان شش ساعت در سطوح دو و پنج ppm، به­صورت معنی‌داری کاهش یافت؛ اگرچه این کاهش در سطح 10 ppm­ معنی­دار نبود. کاربرد 24-اپی­براسینواستروئید (دو ppm­­) بعد از گذشت 24 ساعت، موجب افزایش بسیار معنی‌دار در بیان ژن SMT به میزان شش برابر شد. تیمار  10  ppm هورمون 24-اپی­براسینواستروئید بعد از گذشت 24 ساعت، بیان ژن SMT را به­صورت معنی‌داری کاهش داد. بیان این ژن در تیمار دمای بالا، 24 ساعت پس از شروع تنش دمای بالا (بدون کاربرد 24-اپی­براسینواستروئید) و بعد از تیمار با 24-اپی­براسینواستروئید (پنج ppm) و تنش دمای بالا نسبت به تیمار دمای نرمال و بدون کاربرد 24-اپی­براسینواستروئید، به‌ترتیب 8/3 و 9/3 برابر افزایش یافت. دو ژن SSR و SMT در مسیر بیوسنتز دایوسجنین با یکدیگر رقابت می­کنند، به­طوری‌که ژن SSR مسیر را به سمت بیوسنتز دایوسجنین و ژن SMT مسیر را به سمت بیوسنتز براسینواستروئید هدایت می­کند (et al., 2020; Zolfaghari et al., 2020 Mohammadi). در این تحقیق، بیان ژن SMT با اعمال تیمار دمای بالا افزایش یافت و احتمالا مسیر به سمت سنتز براسینواستروئید هدایت می‌شود، درحالی­که بیان ژن SSR با اعمال تیمار دمای بالا تا حدودی کاهش یافت. احتمالا تنش دمایی بالا (42 درجه سانتی­گراد) دارای اثر معکوسی بر بیان ژن SSR می­باشد و منجر به کاهش بیوسنتز دایوسجنین می‌شود. در تنش دمایی بالا، شنبلیله تمایل بیشتری به سنتز براسینواستروئید نسبت به دایوسجنین دارد تا قادر به تحمل تنش دمای بالا باشد.

بیان ژن (Sterol side chain reductase) SSR

نتایج بیان نسبی ژن SSR در شکل 3 ارائه شده است. نتایج نشان داد که بیان ژن  SSR تحت شرایط نرمال (دمای 23 درجه سانتی‌گراد) با کاربرد 24-اپی­براسینواستروئید در زمان‌های شش و 24 ساعت، به­صورت معنی‌داری تغییر یافت (شکل 3). همچنین در شرایط نرمال، کاربرد 24-اپی­براسینواستروئید در سطح پنج ppm در هر دو زمان 24 و شش ساعت، منجر به افزایش بیان این ژن به میزان 6/2 و 5/3 برابر شد. بدون کاربرد 24-اپی­براسینواستروئید، بیان ژن SSR تحت تنش دمای بالا افزایش یافت. کاربرد 24-اپی­براسینواستروئید در هر دو زمان، بیان این ژن را نسبت به شرایط دمای بالا و بدون تیمار با 24-اپی­براسینواستروئید کاهش داد. بیشترین میزان بیان ژن SSR در تیمار دمای نرمال و سطح پنج ppm در زمان 24 ساعت به میزان 5/3 برابر به‌دست آمد. بیان این ژن، 24 ساعت پس از شرایط دمای بالا و با کاربرد دوppm  از 24-اپی­براسینواستروئید نسبت به دمای نرمال و عدم کاربرد 24-اپی­براسینواستروئید 9/2 برابر افزایش یافت.

 

 

 

A

 

B

 

 

شکل 2- اثرات سه‌گانه دما، زمان و غلظت­های 24- اپی­براسینواستروئید بر  بیان ژن­های  A)CAS  و B) SMT.  مقایسه میانگین با روش دانکن و در سطح احتمال یک درصد انجام شده است. ستون­هایی با حروف مشابه دارای اختلاف معنی داری با یکدیگر نیستند. بیان تمامی تیمارها با توجه به فرمول 2-ΔΔCT نسبت به تیمار دمای نرمال (23 درجه سانتی­گراد و عدم کاربرد 24- اپی­براسینواستروئید) نرمال شده­اند.

Figure 2. Triple interaction effects of temperature, time, and concentration of 24-epi-brossinosteroid on A) CAS and B) SMT expression. (Mean comparison was performed by Duncan test at 1% of probability level. Columns with similar letters are not significantly different). Expression of all treatments was normalized to normal temperature (23°C and Non-application of 24-epibrassinosteroid) according to the formula 2-ΔΔCT.

 

 

 

 

 

 

 

شکل 3- اثرات سه‌گانه دما، زمان و غلظت­های 24- اپی­براسینواستروئید بر بیان ژن­ .SSR مقایسه میانگین با روش دانکن و در سطح احتمال یک درصد انجام شده است. ستون­هایی با حروف مشابه دارای اختلاف معنی داری با یکدیگر نیستند. بیان تمامی تیمارها با توجه به روش فرمول 2-ΔΔCT نسبت به تیمار دمای نرمال (23 درجه سانتی­گراد و عدم کاربرد 24- اپی براسینواستروئید) نرمال شده­اند.

Figure 2. Triple interaction effects of temperature, time, and concentration of 24-epi-brossinosteroid on SSR expression (Mean comparison was performed by Duncan test at 1% of probability level. Columns with similar letters are not significantly different). Expression of all treatments was normalized to normal temperature (23°C and Non-application of 24-epi-brassinosteroid) according to the formula 2-ΔΔCT.

 

 

این درحالی­است که بیان ژن SSR در تیمار دمای بالا و کاربرد پنج ppm از 24-اپی­براسینواستروئید نسبت به دمای نرمال و عدم کاربرد 24-اپی براسینواستروئید، 2/0 بود؛ این بدین معنی است که بیان این ژن پنج برابر کاهش یافت.

ژن اسکوالن سنتاز (SQS)، نقش مهمی در تنظیم کانال ‌کربن در متابولیت اولیه و ثانویه دارد. نقش تنظیمی این ژن در بیوسنتز استرول در گیاهان، مخمرها و جانوران و همچنین نقش آن در بیوسنتز فیتواسترول‌ها[20] و تری‌ترپن‌ها[21] به اثبات رسیده است.

اسکوالن سنتاز، اولین مرحله آنزیمی مسیر ایزپرونوئیدها[22] را در بیوسنتز استرول و تری‌ترپن‌ها کاتالیز می‌کند. نتایج یک تحقیق نشان داد که بیان ژنCAS  و  SQS با کاربرد سطوح مختلف اتفن به‌ترتیب کاهش و افزایش می­یابند (Diarra et al., 2013). نتایج تحقیق حاضر با نتیجه پژوهش Diarra et al. در هر دو ژن متناقض بود؛ این تناقض احتمالا به علت پاسخ متفاوت دو گیاه شنبلیله و یام به اتفن و 24-اپی­براسینواستروئید می­باشد. همچنین این تناقض ممکن است به علت پاسخ متفاوت هر یک از ژن‌های مسیر بیوسنتز دایوسجنین به این دو تیمار باشد. مسیر بیوسنتز دایوسجنین، دارای پیچیدگی‌های زیادی است (et al., 2019 Mohammadi)؛ بنابراین لزوم تحقیقات بیشتر در مورد شناسایی ابهامات این مسیر و شناسایی محرک‌های مناسب به‌منظور افزایش بیان این ژن‌ها و متعاقبا افزایش محتوی دایوسجنین را می­طلبد. در یک مطالعه‌، بیان ژنSQS  تحت تیمار تنش خشکی طی مراحل مختلف رشدی در گیاه شیرین بیان افزایش یافت (Nasrollahi et al., 2014). در پژوهش حاضر، بیان این ژن تحت تاثیر تیمارهای دمایی و غلظت‌های مختلف 24-اپی­براسینواستروئید نسبت به شرایط نرمال کاهش یافت.

ژن اسکوالن اپوکسیداز(SEP) ، اولین مرحله اکسیژناسیون را در مسیر بیوسنتز استرول‌ها با اکسیدکردن مولکول اسکوالن انجام می‌دهد. آنزیم اسکوالن اپوکسیداز با اکسید کردن اسکوالن، منجر به تشکیل دو و سه- اکسیدواسکوالن[23] می‌شود (Han et al., 2010). در مطالعه‌ای، با بیش­‌بیان[24] دو ژن اسکوالن اپوکسیداز PgSEP1 و PgSEP2 در گل و ریشه گیاه Panax ginsing و همچنین خاموش کردن این ژن‌ها[25] با استفاده از تکنیک RNAi به این نتیجه رسیدند که PgSEP1 دارای نقش تنظیمی در بیوسنتز تری‌ترپن‌ها است، درحالی‌که ژن PgSEP2 در مسیر بیوسنتز فیتواسترول‌ها مؤثر است (Han et al., 2010). در این پژوهش، بیان این ژن در اثر تیمار با تنش دمای بالا افزایش یافت، اما این افزایش فقط در تیمار مدت زمان طولانی تنش دمای بالا مشاهده شد. اعمال تیمار 24-اپی­براسینواستروئید در شرایط نرمال دمایی، موجب کاهش بیان این ژنSEP  در مقایسه با شاهد شد. در شرایط تنش دمای بالا، تیمار­ دو و پنج ppm  (در زمان 24 ساعت) از هورمون 24-اپی­براسینواستروئید، موجب افزایش معنی‌دار بیان ژن اسکوالن اپوکسیداز نسبت به شرایط نرمال شد. بیان این ژن در تیمار دمای بالا و غلظت دو ppm از 24- اپی­براسینواستروئید، بیش از 20 برابر افزایش یافت که نشان‌دهنده این موضوع است که این ترکیب تیماری، به‌منظور افزایش محتوی دایوسجنین در شنبلیه مفید است. در سطح مولکولی براسینواستروئید، موجب تغییر بیان ژن، متابولیسم و بیوسنتز اسیدهای نوکلئیک و پروتئین‌ها می‌شود (Arfan et al., 2019). همچنین براسینواستروئیدها، تحمل گیاهان را در محدوده وسیعی از تنش‌های محیطی از قبیل خشکی، شوری، سرما و گرما افزایش می‌دهند و این افزایش، عموماً به تولید و رونوشت ژن‌های ضد تنش از جمله پروتئین شوک گرمایی وابسته است که نشان‌دهنده افزایش رونوشت ژن‌های مسئول پاسخ به تنش برای بالا بردن تحمل به تنش در درون گیاهان تیمار شده با براسینواستروئید است (Arfan et al., 2019).

سیکلوآرتنول‌سنتاز (CAS)، با تغییر سیکلوآرتنول، ساختارهای استرولی از قبیل استیگمااسترول[26]، سیتواسترول[27]یا کامپسترول[28] را تولید می­کند. در حقیقت، ژن CAS، 2و3- اکسیدواسکوالن را به سیکلوآرتنول تبدیل می‌کند که این ترکیب، پیش ماده مورد نیاز در مسیر تبدیل به دیگر استرول‌های گیاهی محسوب می‌شود(Chen et al., 2009) . در یک بررسی،‌ اثر تنش خشکی بر بیان ژن CAS در مراحل مختلف رشد در گیاه شیرین بیان مورد مطالعه قرارگرفت و نتایج نشان داد که تنش خشکی بر بیان ژن CAS موثر نیست (Nasrollahi et al., 2014). در تحقیق حاضر، بیان ژن CAS در شرایط تنش دمای بالا و در مدت زمان طولانی (24 ساعت پس از اعمال تنش دمایی بالا) افزایش یافت. همچنین اعمال تیمار 24-اپی­براسینواستروئید در شرایط تنش دمای بالا (هم در کوتاه مدت و هم در بلند مدت)، موجب افزایش بیان معنی‌دار ژن مذکور در مقایسه با شاهد (شرایط نرمال) شد. عکس­العمل ژن CAS در شرایط تنش دمای بالا و همراه با کاربرد 24- اپی براسینواستروئید مشابه بود.

در یک تحقیق، تأثیر 24-اپی­براسینواستروئید بر افزایش ژرانیول[29] و کاهش سیترونلول[30] را در اسانس گیاه Pelargonium graveolens تائید شد (Mohamadi Farsani et al., 2016).

اپی­براسینواستروئید، دارای دو فاکتور رونویسی مهم به نام­های BES1 وBZR1 در گیاهان است. در زمان عدم وجود پیام اپی­براسینواستروئید، این دو عامل رونویسی توسط پروتئینی به نام 14-3-3 احاطه می­شوند؛ بنابراین فسفریله نمی‌شوند. در این حالت، عامل BKI1 به گیرنده اپی­براسینواستروئید متصل می‌شود و در نتیجه، کل مجموعه خاموش می­شود
2019)  (Planas et al.,. به­محض اتصال اپی­براسینواستروئید (کاربرد خارجی) به گیرنده، آبشاری از فسفریلاسیون اتفاق می­افتد. در این حالت، پروتئین14-3-3  از دو فاکتور رونویسی BES1 وBZR1 جدا می­شود و امکان فسفریلاسیون این دو فاکتور رونویسی فراهم می‌شود (در ضمن پروتئین 14-3-3 به BKI1 متصل می­شود و مانع از اتصال BKI1 به گیرنده می‌شود). مجموعه این رخدادها، منجر به بیان و رونویسی ژن­های پاسخ دهنده به اپی­براسینواستروئید می‌شود 2019) (Planas et al.,.

در گیاهان، سیکلوآرتنول ترکیب آغازی برای شروع بیوسنتز استرول‌هاست که سوبسترای C24-methyltransferase هم می‌باشد (Diener et al., 2000). متیلاسیون C24 سیکلوآرتنول، یک جایگاه اصلی تنظیمی در بیوسنتز استرول‌هاست (Nes et al., 1999). تبدیل سیکلوآرتنول به 24-متیلن سیکلوآرتنول، عمدتا به­وسیله یک نوع استرول C24-methyltransferase وابسته به (SMT1) S-adenosyll-Met 1 صورت می‌گیرد (Schaeffer et al., 2001). در تحقیق حاضر، بیان ژن SMT
(Sterol methyltransferase) در شرایط تنش دمای بالا نسبت به شرایط نرمال دمایی افزایش یافت و این افزایش در مدت زمان طولانی تنش نسبت به مدت زمان کوتاه، بیشتر بود. اعمال تیمار 24-اپی­براسینواستروئید در شرایط دمایی نرمال، موجب کاهش بیان ژن مذکور شد. در شرایط تنش دمای بالا، تیمار دو ppm از 24-اپی­براسینواستروئید، بیان ژن SMT را به­صورت معنی‌داری افزایش داد.

متابولیت­های ثانویه در پاسخ به محرک­­ها پس از مجموعه­ای از واکنش­های فسفوریلاسیون و دفسفوریلاسیون پروتئین­های غشای سلول، ایجاد جریان­ کلسیمی، فعال شدن پروتئین کینازها و    NADPH  اکسیدازها، تولید گونه­های فعال اکسیژن و در نهایت بیان ژن­های دفاعی در سلول های گیاهی تولید می­شوند (Zhao el al., 2006) . Arfan et al.  (2019) نشان دادند که کاربرد اپی­براسینواستروئید تحت شرایط استرس دمای پایین در آرابیدوپسیس، منجر به افزایش فعالیت کاتالاز، سوپراکسید دیسموتاز، پلی فنول اکسیداز و آسکوربات پراکسیداز شد. نتایج آن­ها نشان داد که کاربرد اپی­براسینواستروئید، منجر به افزایش H2O2 و متعاقبا افزایش مقادیر NO می‌شود. این افزایش‌ها باعث افزایش بیان ژن‌های مرتبط با سیستم دفاعی گیاه می­شوند (آنتی اکسیدان­‌ها) و در نهایت مقاومت گیاه افزایش می­یابد. نتایج مطالعات مختلف نشان می­دهد که تحریک­کننده­هایی از قبیل سالیسیلیک اسید، متیل جاسمونات­ها، براسینواستروئیدها، منجر به تغییر و تنظیم میزان بیوسنتز، تجمع و تبادل مواد ذخیره شده در واکوئل، تبدیل و یا تجزیه متابولیت­های گیاهی می­شوند و در نهایت میزان متابولیت­های اولیه و ثانویه تغییر می­یابند (Odjakova  and Hadjiivanova., 2001).

در این تحقیق سطوح دو و پنج ppm­  هورمون 24-اپی­براسینواستروئید در برخی از ژن­ها، بیان ژن­ها را به­صورت موثری افزایش داد، در صورتی­که اثر سطح 10 ppm تقریبا در تمامی ژن­های مورد مطالعه به­صورت معنی­داری کمتر از سطوح دو و پنج ppm بود. با توجه به این‌که براسینواستروئیدها در تمامی اندام­های گیاهی و در مقادیر بسیار ناچیز حضور دارند، بنابراین به­نظر می­رسد که سطح 10 ppm ‌موجب مسمومیت گیاه شده است. در این تحقیق، تیمار شنبلیله تحت شرایط تنش دمای بالا و سطوح مختلف 24-اپی­براسینواستروئید، احتمالا منجر به افزایش گونه­های فعال اکسیزن شده است و متعاقب آن، سطوح بیان ژن­های دخیل در مسیر دایوسجنین به­عنوان یک مکانیسم دفاعی به­صورت معنی‌داری افزایش یافت. در حقیقت گیاه شنبلیله به­منظور مواجه با اثرات تنش دمای بالا و سطوح مختلف24-اپی­براسینواستروئید، بیان ژن­های بیوسنتز دایوسجنین را افزایش داده است. نتایج متناقصی در مورد استفاده از محرک­های مختلف و تغییرات میزان متابولیت­های ثانویه وجود دارد. این بدین معنی است که گیاهان مختلف، پاسخ­های متفاوتی نسبت به محرک­ها از خود نشان می­دهند. پاسخ گیاهان با توجه به مدت زمان در معرض بودن محرک، مرحله رشدی و غلظت­های مختلف محرک­ها بسیار متفاوت است؛ بنابراین شناسایی بهترین محرک، حساس­ترین مرحله رشدی گیاه و مناسبترین غلظت محرک­ها، از فاکتورهای موثر در افزایش کمیت متابولیت­های گیاهی است (Angelova et al., 2006: Parsa et al., 2016; Namdeo, 2007) .

با توجه به الگوی بیان ژن­های مورد مطالعه در این تحقیق، می­توان ژن­ها را به سه گروه تقسیم کرد. گروه اول شامل ژن­های SEP و SMT بود و بیان این دو ژن تحت شرایط دمای نرمال با کاربرد 24-اپی­براسینواستروئید و یا عدم کاربرد این هورمون، تغییرات قابل توجهی نداشت، درحالی­که اثر تنش دمای بالا و کاربرد 24-اپی­براسینواستروئید به­صورت موثری موجب افزایش بیان این ژن­ها شد. ژن SQS در گروه دوم قرار گرفت، چراکه بیان این ژن در هیچ‌کدام از تیمارهای آزمایشی به­صورت موثری تحت تاثیر قرار نگرفت؛ بنابراین به­نظر می­رسد که این ژن، کاندید مناسبی برای مهندسی مسیر بیوسنتز دایوسجنین نمی­باشد. ژن CAS نیز در گروه سوم جای گرفت، به­طوری‌که بیان آن تحت تاثیر تیمار ترکیبی تنش دمای بالا و هورمون 24-اپی­براسینواستروئید به­صورت قابل توجهی تغییر کرد.

 

نتیجه گیری کلی

در این تحقیق، به­منظور مطالعه الگوی بیان ژن‌های مرتبط با بیوسنتز دایوسجنین و کاربرد دو محرک خارجی، از تیمار دمای بالا (42 درجه سانتی‌گراد در مقابل 23 درجه سانتی‌گراد) و سطوح مختلف 24-اپی­براسینواستروئید و دو زمان برداشت مختلف (شش و 24 ساعت) استفاده شد. نتایج این تحقیق نشان داد که این ژن‌ها دارای عکس­العمل‌های متفاوتی نسبت به تیمار دمای بالا و سطوح مختلف 24-اپی­براسینواستروئید هستند. در ضمن این دو تیمار، به­صورت موثری موجب افزایش بیان برخی از ژن­های این مسیر شدند. با توجه به افزایش بیان ژن­های مذکور، می­توان از تنش دمایی و هورمون 24-اپی براسینواستروئید در مهندسی مسیر بیوسنتز دایوسجنین استفاده کرد.

 

 

D

B

A

E

REFERENCES

  1. Abbasi, A. R., Rahmani, M. S. & Vafaei, Y. (2011). Plant Biochemistry (1st ed). University Tehran Press.
  2. Acharya, S. N., Thomas, J. E. & Basu, S. K. (2008). Fenugreek, an alternative crop for semiarid regions of North America. Crop Science, 12(2), 149-154.
  3. Angelova, Z., Georgiev, S. & Roos, W. (2001). Elicitation of plants. Biotechnology & Biotechnological Equipment, 20, 72-83.
  4. Anwar, A., Liu, Y., Dong, R., Bai, L., Yu, X. & Li, Y. (2018). The physiological and molecular mechanism of brassinosteroid in response to stress: A review. Biological Research, 51(1), 46.
  5. Arfan, M., Zhang, D. W., Zou, L. J., Luo, S. S., Tan, W. R., Zhu, T. & Lin, H. H. (2019). Hydrogen peroxide and nitric oxide crosstalk mediates brassinosteroids induced cold stress tolerance in Medicago truncatula. International Journal of Molecular Sciences, 20 (1), 144- 159.
  6. Chaudhary, S., Chikara, S. K., Sharma, M. C., Chaudhary, A., Alam Syed, B., Chaudhary, P. S., Mehta, A., Patel, M., Ghosh, A. & Iriti, M. (2015). Elicitation of Diosgenin Production in Trigonella foenum-graecum (Fenugreek) Seedlings by Methyl Jasmonate. International Journal of Molecular Sciences, 16(12), 29889-29899.
  7. Chen, D., Chen, Y., Yang, Z., Zhang, Y. & Xiao, L. (2009). Molecular cloning and expression of cycloartenol synthase gene from Dioscorea zingiberensisActa Botanica, 29 (2), 221-228.
  8. Ciura, J., Szeliga, M., Grzesik, M. & Tyrka, M. (2017). Next-generation sequencing of representational difference analysis products for identification of genes involved in diosgenin biosynthesis in fenugreek (Trigonella foenum-graecum). Planta, 245(5), 977-991.‏
  9. Diarra, S. T., He, J., Wang, J. & Li, J. (2013). Ethylene treatment improves diosgenin accumulation in in vitro cultures of Dioscorea zingiberensis via up-regulation of CAS and HMGR gene expression. Electronic Journal of Biotechnology, 16(5), 6-16.
  10. Diener, A. C., Li, H., Zhou, W. X., Whoriskey, W. J., Nes, W. D. & Fink, G. R. (2000). Sterol methyltransferase 1 controls the level of cholesterol in plants. The Plant Cell, 12(6), 853-870.
  11. Dini, M. (2006). Scientific name of medicinal plants used in traditional medicine. Forest and Rangeland Research Institute Publication, Iran, 299-300.‏
  12. Han, J. Y., In, J. G., Kwon, Y. S. & Choi, Y. E. (2010). Regulation of ginsenoside and phytosterol biosynthesis by RNA interferences of squalene epoxidase gene in Panax ginsengPhytochemistry, 71(1), 36-46.‏
  13. Helambe, S. & Dande R. (2012). Fenugreek (Trigonella foenum- graecum ): An Overview. International Journal of Current Pharmaceutical Review and Research, 4, 169 – 187.
  14. Jager, C. E., Symons, G. M., Ross, J. J. & Reid, J. B. (2008). Do brassinosteroids mediate the water stress response? Physiologia Plantarum, 133, 417– 425.
  15. Joanna, C., Magdalena, S. & Tyrka, M. (2015). Optimization of in vitro culture conditions for accumulation of diosgenin by fenugreek. Medicinal Plants Studies, 3(3), 22-25.
  16. Kawatra, M., Kaur, K. & Kaur, G. (2019). Effect of Osmo priming on sucrose metabolism in spring maize, during the period of grain filling, under limited irrigation conditions. Physiology and Molecular Biology of Plants, 25 (6), 1367-1376.
  17. Lamaoui, M., Jemo, M., Datla, R. & Bekkaoui, F. (2018). Heat and drought stresses in crops and approaches for their mitigation. Frontiers in Chemistry, 6, 26.
  18. Livak, K. J. & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT Methods, 25(4), 402-408.
  19. Mohamadi farsani, M., Ghasemi pirbalouti, A., Bakheshi khaniki, G. & Momtaz, H. (2016).  Effect of Paclobutrazol and Brassinosteroid elicitors on expression gene 1-deoxy xylulose-5-phosphate reductoisomerase and its relationship with the biosynthesis of monoterpene carvacrol and thymol in Thymus daenenesis under drought stress. Journal of Iranian Plant Ecophysiological Research, 11(43), 25-28.
  20. Mohammadi, M., Mashayekh, T., Rashidi‐Monfared, S., Ebrahimi, A. & Abedini, D. (2019). New insights into diosgenin biosynthesis pathway and its regulation in Trigonella foenumgraecum L. Phytochemical Analysis, 31 (2), 1-13.
  21. Namdeo, A. (2007). Plant cell elicitation for production of secondary metabolites: A review. Pharmacognosy Reviews, 1(1). 69-79.
  22. Nasrollahi, V., Mirzaie-asl, A., Piri, K., Nazeri, S. & Mehrabi, R. (2014). The effect of drought stress on the expression of key genes involved in the biosynthesis of triterpenoid saponins in liquorice (Glycyrrhiza glabra). Phytochemistry, 103, 32-37.
  23. Nes, W. D., McCourt, B. S., Marshall, J. A., Ma, J., Dennis, A. L., Lopez, M. & He, L. (1999). Site-Directed Mutagenesis of the Sterol Methyl Transferase Active Site from Saccharomyces cerevisiae results in formation of novel 24-ethyl sterols. The Journal of Organic Chemistry, 64 (5), 1535-1542.‏
  24. Odjakova, M. & Hadjiivanova, C. (2001). The complexity of pathogen defense in plants. Bulgarian Journal of Plant Physiology, 27(1-2), 101-109.
  25. Oksman-Caldentey, K. M. & Inzé, D. (2004). Plant cell factories in the postgenomic era: New ways to produce designer secondary metabolites. Trends Plant Science, 9 (9), 433-440.
  26. Osman, M. E., El-Feky, S. S., Abo-Hamad, S. A. & Seliem, H. S. (2015). Improvement of harmful effects induced by temperature stress on Trgonella foenum-graecum by on putrescine. The Egyptian Journal of Experimental Biology, 11(2), 197-205.
  27. Pant, G., Hemalatha, S., Arjunan, S., Malla, S. & Sibi, G. (2013). Effect of heat stress in synthesis of heat shock proteins and antioxidative enzyme response in Trigonella foenum-graceum Journal of Plant Sciences1(4), 51-56.
  28. Parsa, M. & Zeinali, A. (2016). Effects of salicylic acid elicitor on the production of tropane alkaloids (atropine and scopolamine) in hairy roots and in vitro roots cultures of Hyoscyamus niger Scientific Journal Management System, 32(4), 655-666.
  29. Planas-Riverola, A., Gupta, A., Betegón-Putze, I., Bosch, N., Ibañes, M. & Caño-Delgado, A. I. (2019). Brassinosteroid signaling in plant development and adaptation to stress. Development, 146 (5), 151894.
  30. Schaeffer, A., Bronner, R., Benveniste, P. & Schaller, H. (2001). The ratio of campesterol to sitosterol that modulates growth in Arabidopsis is controlled by Sterol methtltransferase. The Plant Journal, 25(6), 605-615.‏
  31. Tetenyi, P. (2002). Chemical variation (Chemodifferentiation) in medicinal and aromatic plant. Acta Horticulture, 76, 15-21.
  32. Wink, M. (2010). Functions and biotechnology of plant secondary metabolites (2th). John wiley & Son.
  33. Zhao, J., Davis, L. C. & Verpoorte, R. (2005). Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnology Advances, 23(4), 283-333.
  34. Zolfaghari, F., Rashidi-Monfared, S., Moieni, A., Abedini, D. & Ebrahimi, A. (2020). Improving diosgenin production and its biosynthesis in Trigonella foenum-graecum hairy root cultures. Industrial Crops and Products, 145, 112075.

 

[1] -Legouminosae

[2] -Rosaceae

[3] Testosterone

[4] Glucocorticoids

[5] Progesterone

[6] Isoprenoids

[7] Isopentyl pyrophosphate

[8] Solanaceae

[9] Phytohormones

[10] Brassinosteroids

[11] Auxin

[12] Gibberellin

[13] Cytokinin

[14] Ethylene

[15] Abscisic acid

[16] Degeberate

[17] High Performance Liquid Chromatography

[18] Ethephon                            

[19]Relative standard curve method

[20] Phytosterol

[21] Triterpene

[22] Isopranoids

[23] 2, 3- oxidosqualene

[24] Overexpressing

[25] Gene silencing

[26] Stigmasterol

[27] Cytosterol

[28] Campesterol

[29] Geraniol

[30] Citronellal