اثر نانومحرک‌ها بر بیان ژن‌های دخیل در زیست ساخت آلکالوئیدهای شقایق شرقی (Papaver orientale L.)

نوع مقاله : مقاله پژوهشی

نویسندگان

1 کارشناس ارشد، گروه زراعت و اصلاح نباتات، پردیس کشاورزی و منابع طبیعی دانشگاه تهران

2 استاد، گروه زراعت و اصلاح نباتات، پردیس کشاورزی و منابع طبیعی دانشگاه تهران

3 استادیار، گروه زراعت و اصلاح نباتات، پردیس کشاورزی و منابع طبیعی دانشگاه تهران

4 استادیار، گروه نانوتکنولوژی، پژوهشکده بیوتکنولوژی کشاورزی ایران، کرج

5 استادیار، پژوهشکده کشاورزی هسته ای، پژوهشگاه علوم و فنون هسته ای، سازمان انرژی اتمی ایران، کرج

چکیده

خصوصیات دارویی گیاهان خانواده خشخاش، مربوط به قابلیت تولید آلکالوئیدهای بنزیل ایزوکوئینولین (BIAs) است. آلکالوئیدهای BIA گروه متنوعی از ترکیبات نیتروژن دار هستند که پراکنش محدودی در بین گیاهان دارند. این آلکالوئیدها علاوه بر خاصیت دارویی، در مکانیسم دفاعی گیاه نقش بسیار مهمی ایفا می‌کنند. در این پژوهش، اثر محرک­ (الیسیتور)‌های نانوذره نقره سبز و نقره شیمیایی، نانولوله­های کربنی، گرافن با پوشش نانوذره نقره شیمیایی و همچنین اثر ترکیبی گرافن و نانوذره نقره سبز بر میزان بیان نسبی ژن‌های مسیر زیست­ساخت (بیوسنتز) بنزیل­ایزوکوئینولین آلکالوئیدها (DBOX ،COR  وT6ODM ) در دروایه­ی (سوسپانسیون) یاخته­ای Papaver orientale L. با غلظت 50 میلی­گرم در لیتر در دو زمان ۴۸ و ۷۲ ساعت پس از اعمال محرک (الیسیتور) مورد بررسی قرار گرفت. تحت تأثیر این محرک­ها، بیان نسبی ژن­ها به شدت تغییر کرد، به‌طوری‌که در هر دو ژن COR و DBOX بیشترین میزان بیان نسبی در ۴۸ ساعت پس از تیمار گرافن با پوشش نانوذره نقره شیمیایی، به‌ترتیب 96/57 و 34/8 به­دست آمد. در ژنT6ODM  بیشترین بیان نسبی مربوط به تیمار محرک ترکیبی گرافن به همراه نانوذره نقره سبز، به میزان 77/45 برابر بود. نتایج حاصل از این پژوهش حاکی از آن است که محرک­های مختلف، تأثیرات متفاوتی بر میزان ژن­های دخیل در زیست­ساخت آلکالوئیدهای این گیاه دارند. این محرک­ها بسته به میزان سمیت و مسیرهای سیگنالینگی که در سلول فعال می­کنند، بیان ژن­های دخیل در زیست ساخت  آلکالوئیدها را تحت تأثیر  خود قرار دادند.

کلیدواژه‌ها


عنوان مقاله [English]

The effect of nano elicitors on the expression of the genes involved in alkaloids biosynthetic pathway in Papaver orientale L. suspension culture

نویسندگان [English]

  • Mohsen Rahimi Sherbaf Moghadas 1
  • MohammadReza Naghavi 2
  • Monighe Sabokdast 3
  • Elahe Motemadi 4
  • Jaber Nasiri 5
1 Agronomy and Plant Breeding Department, University College of Agriculture & Natural Resources, University of Tehran
2 Agronomy and Plant Breeding Department, University College of Agriculture & Natural Resources, University of Tehran
3 Agronomy and Plant Breeding Department, University College of Agriculture & Natural Resources, University of Tehran
4 Nanotechnology Department, Iranian Agricultural Biotechnology Research Institute, Karaj
5 Nuclear Agriculture Research School, Nuclear Science and Technology Research Institute, AEOI, Karaj, Iran
چکیده [English]

Pharmacological properties of Papaver family plants referred to Benzylisoquinoline alkaloid (BIAs) production. The BIAs alkaloids are a diverse group of nitrogenous compounds which have a limited distribution among various plant species. In addition to their medicinal properties, they have a crucial role in the plant defense mechanisms. In the current study, the effects of elicitors including green silver nanoparticles, chemical silver nanoparticles, carbon nanotubes, graphene coated with chemical silver nanoparticles, and combination of graphene and green silver nanoparticles were investigated on the relative expression of BIAs biosynthesis pathway genes (DBOX, COR, and T6ODM) in the Papaver orientale L. cell suspension of with the concentration of 50 mg/L at 48 and 72 h after the elicitor applications. There were significant changes in the relative expression of these genes due to elicitor applications. However, the highest transcriptional activity of DBOX and COR genes observed at 48 h after utilization of graphene coated with chemical silver nanoparticles with the values of 57.96 and 8.34 fold-change, respectively. While, there was an up-regulation of T6ODM gene in the combination application of graphene and Green silver nanoparticles (45.77 fold). These results suggested that the application of various elicitors in this plant could accompany by diverse changes in the expression of alkaloids biosynthetic genes, which depends on the toxicity level of elicitors and elicitors’ mediated-activation of signaling paths.

کلیدواژه‌ها [English]

  • Benzylisoquinoline alkaloids
  • Cell suspension
  • gene expression
  • green silver nanoparticles synthesis
  • Papaver orientale L

مقدمه

 

متابولیت­های ثانویه گیاهی، از متابولیت­های اولیه با فعالیت­های مختلف فیزیولوژیکی می‌باشند. این متابولیت­های ثانویه، نقش مهم و کلیدی در بقا و سازگاری گیاه دارند. اگرچه متابولیت­های ثانویه، تأثیر آنی در بقای گیاه ندارند، اما اثرات طولانی مدت دارند (Verma & Shukla, 2015). شقایق شرقی (Papaver orientale L.) از خانواده Papaveraceae و گیاهی تتراپلوئید (2n=4x=28) است. این گونه یکی از مهم‌ترین گیاهان دارویی است، زیرا غنی از متابولیت­های بنزیل­ایزوکوئینولین مانند تبائین (9%) و اوریپاوین (20%) است (Shafiee et al., 1975). سه گونه P. bracteatum، P. pseudo-orientale و P. orientale در گروه اکسیتونا[1] طبقه‌بندی می‌شوند که بسیار شبیه به هم می‌باشند. نواحی پراکنش این گیاه، نواحی شمال غرب کشور ایران، شمال شرق کشور ترکیه و جنوب قفقاز است (Nyman & Bruhn, 1979). کشت سوسپانسیون[2] سلول گیاهی، منابعی از سلول­های یکنواخت از لحاظ ژنتیکی و فیزیولوژیکی را فراهم می­کند که می­تواند به­سادگی توسط روش­های الیسیتیشن[3] دست‌کاری شود و به این دلیل پتانسیل زیادی برای کاربردهای صنعتی مانند تولید متابولیت­های ثانویه و ریزازدیادی دارد. آن‌ها همچنین چندین مزیت دیگر از جمله مطالعه پاسخ­های سلولی، چرخه سلولی، تکثیر و رشد در غیاب فرایندهای توسعه‌یافته‌ای که در گیاهان کامل و اندام­های گیاهی رخ می­دهد، بر گیاه کامل دارند، (Lee et al., 2007). محرک (الیسیتور)، به مولکول‌هایی با منشأ زیستی یا غیر زیستی اطلاق می­شود که با تحریک سیگنال­های سلولی و برهم‌کنش مولکولی میان گیرنده­های گیاهی در سطح غشای سلولی یا سیتوپلاسمی و محرک، موجب شناسایی آن‌ها می­شوند. در نتیجه سیگنال دریافتی توسط سلول­های گیاهی، بیان ژن­های مرتبط در مسیر را تحریک می­کنند و موجب سنتز متابولیت­های ثانویه در گیاهان یا کشت سلولی آن‌ها می­شوند. متابولیت­های ثانویه، در پاسخ به محرک­ها پس از مجموع واکنش­های فسفوریلاسیون و دفسفوریلاسیون پروتئین­های غشایی، نوسانات سیتوزولی یون کلسیم، دپلاریزاسیون غشاء پلاسمایی، خروج یون­های کلر و پتاسیم و هجوم یون هیدروژن، قلیایی شدن خارج سلولی و اسیدی شدن سیتوپلاسم، تولید گونه­های اکسیژن فعال (ROS) و درنهایت بیان ژن­ پاسخ دفاعی تولید و تجمع می­یابند ( Zhao et al., 2005; Suzuki et al., 1995; Namdeo, A. G. 2007). از جمله الیسیتورهایی که امروزه تمایل به استفاده از آن‌ها افزایش یافته است، می­توان به نانوالیسیتورها اشاره نمود. نانوالیسیتورهای مبتنی بر کربن نظیر گرافن و نانولوله­های کربنی[4] در مطالعات مختلفی استفاده شده‌اند. القای نانولوله‌های کربنی بر کالوس­های گیاه مرزه (Satureja khuzestanica) توسط (Ghorbanpour & Hadian) 2015 انجام شد. در این مطالعه، افزایش غلظت نانولوله‌های کربنی تا ۵۰ میکروگرم بر میلی­لیتر، باعث افزایش رشد کالوس­ها شد و در غلظت ۵۰۰ میکروگرم بر میلی­لیتر، رشد کالوس را کاهش داد. نانومواد بر پایه کربن با مورفولوژی­های مختلف می­تواند رشد سلول، جوانه­زنی و رشد گیاه را فعال کند. هنگامی‌که در کشت سلولی گیاه توتون (tobacco) به محیط کشت نانومواد بر پایه کربن مانند نانولوله­های کربنی، گرافن با غلظت 50 مایکرو­گرم در میلی­لیتر اضافه شد، افزایش 46-22 درصد رشد سلولی را به همراه داشت (Lahiani et al., 2016).

 علاوه بر روش های سنتز شیمیایی، روش­های زیست ساخت، توجه زیادی را به‌خود جلب کرده­اند، زیرا رویکرد طرفدار محیط‌زیستی و ساده­ای دارد (Goudarzi et al., 2016). استفاده از نانوذره نقره و نانو ذره دی­اکسید تیتانیوم در کشت دروایه (سوسپانسیون) یاخته­ای شقایق شرقی، منجر به افزایش بیان نسبی ژن­های COR،   DBOXو T6ODM می­شود (Shirvani & Naghavi, 2017). همچنین در مطالعه­ای دیگر، تیمار متیل جاسمونات (MJ) و سالسیلیک اسید (SA) بر ریشه­های موئین گیاه شقایق شرقی، باعث افزایش میزان آلکالوئیدها شد، به‌طوری‌که محرک MJ در  48 ساعت پس از اعمال محرک، باعث بیشترین میزان تجمع آلکالوئیدها شد (Hashemi & Naghavi, 2015).

با توجه به این‌که در گیاه شقایق شرقی، پتانسیل این نانوذرات مورد بررسی قرار گرفته است، در این تحقیق تلاشی صورت گرفت تا اثر نانوذرات مختلفی نظیر نانوذرات نقره سبز[5]، نانوذره نقره شیمیایی، گرافن و نانولوله­های کربنی در میزان بیان ژن­های دخیل در مسیر بیوسنتزی آلکالوئیدها مورد بررسی قرار گیرد. اهمیت این موضوع  به این خاطر است که این ژن­ها، آنزیم­هایی را کد می­کنند تا این مسیر را تنظیم کنند. بنابراین افزایش یا کاهش بیان آ‌ن‌ها می­تواند منجر به کاهش و یا افزایش میزان تولید آلکالوئیدهای مدنظر باشد.

 

مواد و روش­ها

کشت بافت

بذرهای گیاه شقایق شرقی (P. orientale L.) از شرکت سوئیسی Botanik samen تهیه شد. برای به‌دست آوردن گیاهچه های سترون، بذرها با الکل 70 درصد به مدت یک دقیقه و سپس با هیپوکلریت 5/2 درصد به مدت شش تا هفت دقیقه تحت شرایط سترون، ضدعفونی شدند و پس از سه بار شستشو با آب مقطر دوبار سترون، در محیط کشت 1/2MS فاقد هورمون با 30 گرم در لیتر ساکارز و هفت گرم در لیتر آگار و همچنین یک گرم در لیتر زغال فعال در ظرف سترون کشت شدند و به اتاق کشت با دمای C°2±23 و تناوب نوری 16 ساعت روشنایی و هشت ساعت تاریکی منتقل شدند (Shirvani & Naghavi, 2017). جوانه‌زنی بذرها پس از هفت روز آغاز شد. پس از دست­یابی به گیاهچه­هایی به ارتفاع 8 تا 10سانتی­متر، ریز نمونه­های مناسب از ناحیه برگ­های حقیقی، ریشه و طوقه برای فاز کال­زایی انتخاب شدند و به محیط کال­زایی، یعنی محیط MS کامل با 30 گرم در لیتر ساکارز و هفت گرم در لیتر آگار به همراه تیمار هورمونی یک میلی گرم در لیتر NAA و 5/0 میلی­گرم در لیتر BAP منتقل شدند. پس از چند مرتبه واکشت، کالوس ریشه به‌عنوان بهترین کالوس برای کشت دروایه یاخته­ای انتخاب شد و به محیط کشت دروایه یاخته­ای MS کامل با 30 گرم در لیتر ساکارز، ولی بدون آگار با همان غلظت هورمونی منتقل شد. کالوس‌های انتخابی در شرایط کاملاً سترون و در زیر هود لامینار، به‌صورت خیلی خردشده به هر ارلن به‌عنوان یک واحد آزمایشی به مقدار 5/0 گرم اضافه شد. ارلن­ها به شیکر انکوباتور با دمای C°2±25 و rpm130 در شرایط کاملاً تاریک منتقل شدند. پس از تکثیر کالوس­ها و رسیدن به رشد مطلوب در فاز نمایی، تمامی ارلن­ها با نانومحرک­ها (نانوذره نقره سبز، نانوذره نقره شیمیایی، نانولوله­های کربنی، گرافن با پوشش نانوذره نقره و گرافن به همراه نانوذره نقره سبز) با غلظت50 میلی­گرم در لیتر تیمار شدند. هر دروایه به­منزله یک نمونه و برای هر بازه زمانی نیز یک شاهد در نظر گرفته شد و به دروایه شاهد، یک میلی­لیتر آب مقطر اضافه شد. برای بررسی میزان بیان نسبی ژن­های دخیل در تولید آلکالوئیدها، کالوس­های رشد یافته در دروایه یاخته­ای در دو بازه زمانی 48 و 72 ساعت بعد از اعمال تیمار در فریزر 80- نگهداری شدند.

استخراج RNA

استخراج RNA با استفاده از کیت P-Biozol انجام شد. بدین منظور، 1/0 گرم از کالوس­های ساییده شده با نیتروژن مایع برای استخراج RNA استفاده شد. برای اطمینان از کیفیت مطلوب RNA استخراج شده و تعیین غلظت آن، از دستگاه نانودراپ استفاده شد؛ علاوه بر این، به‌منظور بررسی کیفیت، RNA کل استخراج شده بر روی ژل آگارز 2/1 % برده و الکتروفورز شد و برای حذف DNA ژنومی، نمونه­ها مطابق با روش شرکت فرمنتاز، با استفاده از آنزیم DNase I تیمار شدند. برای ساخت cDNA، یک میکروگرم از هر نمونه RNA انتخاب و سپس با استفاده از دستورالعمل شرکت سازنده برای کلیه نمونه­ها، cDNA ساخته شد. با استفاده از آغازگر ژن مرجع Actin روی تمام cDNA های ساخته شده، واکنش PCR انجام شد. پس از اطمینان از cDNA ساخته شده، واکنش Real-time PCR با استفاده از کیت 5x HOT FIREPol EvaGreen ® qPCR Mix Plus (ROX) و با دو تکرار بیولوژیک و سه تکرار تکنیکی انجام شد. برای منظور،  cDNAهای استفاده­شده هم غلظت شدند و برای تمام آغازگرها (جدول1) میزان 400 نانوگرم در میکرولیتر استفاده شد. کنترل برای کمیت سنجی با کالوس هایی انجام شد که هیچ‌گونه تیمار الیستوری بر آن‌ها اعمال نشد. در نهایت، تجزیه ­و تحلیل داده­ها با استفاده از روش مقایسه­ای  Efficiency-∆∆CT انجام شد.

 

 

جدول 1- نام و توالی آغازگرهای مورداستفاده برای qRT-PCR درگیاه P. orientale L.

Table 1. Name and sequence of primers used in qRT-PCR for P. orientale

Primer

Accession no.

Sequence

COR -F

COR -R

FJ624147

TTGATTGGGAACTAACGGCAGAAG

TGAAAGGTCCAGTCGGTGATAACA

T6ODM -F

T6ODM -R

GQ500139

AAAACTCCCAGTGCCTCTCA

ACCCTTAATCTCGGCTGCTT

DBOX -F

DBOX -R

GQ500140

TGTGAGAAACTGAAGAACACACAAT

AAGGACTCAGACCACTGAAAGACG

Actin-F

Actin-R

AB574417.1

GCAATCCTCCGTTTGAATCTTGCTG

AATTTCCCGTTCCGCAGTGGTG

 

 

نتایج و بحث

بررسی بیان نسبی ژن­های دخیل در مسیر زیست ساخت  آلکالوئیدها

اثر نانوذره نقره گیاهی

نتایج نشان داد که ژن DBOX  پس از گذشت 48 ساعت از اعمال محرک، 96/0 برابر افزایش بیان نسبی داشت، درحالی‌که در زمان 72 ساعت، میزان بیان نسبی این ژن افزایش یافت و به 6/3 برابر رسید. بیان نسبی ژنCOR  پس از گذشت 48 ساعت از اعمال محرک، 7/3 برابر افزایش نشان داد، در حالی‌که در زمان 72 ساعت، میزان بیان نسبی این ژن افزایش یافت و به 41/11 برابر رسید. بیان نسبی ژنT6ODM  پس از گذشت 48 ساعت از اعمال محرک، 07/0 برابر نشان داد، در حالی‌که در زمان 72 ساعت میزان بیان نسبی این ژن نسبت به شاهد افزایش یافت و به 79/39 برابر رسید (شکل 1).

اثر نانوذره نقره شیمیایی

نتایج نشان داد که بیان ژنDBOX  پس از گذشت 48 ساعت از اعمال محرک، 69/4 برابر افزایش داشت، درحالی‌که در زمان 72 ساعت، میزان بیان نسبی این ژن به 76/4 برابر رسید. بیان نسبی ژنCOR  پس از گذشت 48 ساعت از اعمال محرک، 02/1 برابر افزایش داشت، درحالی‌که در زمان 72 ساعت، میزان بیان نسبی این ژن به 85/24 برابر رسید. بیان ژنT6ODM پس از گذشت 48 ساعت از اعمال محرک، 64/2 برابر افزایش داشت، درحالی‌که در زمان 72 ساعت، میزان بیان نسبی این ژن  به 02/4 برابر رسید ( شکل2).

اثر محرک گرافن با پوشش نانوذره نقره

نتایج نشان داد که بیان ژن DBOX   48 ساعت چس از اعمال محرک، 34/8 برابر افزایش داشت، درحالی‌که در زمان 72 ساعت، میزان بیان نسبی این ژن به 78/4 برابر رسید. 48 ساعت پس از اعمال محرک، بیان ژن COR  96/57 برابر افزایش داشت، درحالی‌که در زمان 72 ساعت، میزان بیان نسبی این ژن به20/12 برابر رسید.  بیان نسبی ژنT6ODM   پس از گذشت 48 ساعت از اعمال محرک، نتیجه­ای به همراه نداشت، درحالی‌که در زمان 72 ساعت، میزان بیان نسبی این ژن  به 68/1 برابر رسید (شکل3).

 

 


شکل1- اثر نانوذره نقره گیاهی بر بیان نسبی ژن­های COR ، DBOX  وT6ODM  در زمان 48 و 72 ساعت  برای کالوس­های به‌دست آمده از گیاه P. oreintale

Figure 1. Effect of green silver nano particle on COR, DBOX and T6ODM gene expressions in P. orientale L. suspension culture.

 

 

شکل2- اثر نانوذره نقره شیمیایی بر بیان ژن­های COR ، DBOX  وT6ODM  در زمان 48 و 72 ساعت  برای کالوس­های به‌دست آمده از گیاه P. oreintale

Figure 2. Effect of chemical silver nano particle on COR, DBOX and T6ODM gene expressions in P. orientale L. suspension culture.

 

 

اثر نانولوله­های کربنی

نتایج نشان داد که بیان ژن DBOX  پس از گذشت 48 ساعت از اعمال محرک، 096/1 برابر افزایش داشت، درحالی‌که در زمان 72 ساعت، میزان بیان نسبی این ژن به 56/0 برابر رسید. 48 ساعت پس از اعمال محرک، بیان نسبی ژنCOR  82/9 برابر افزایشداشت، درحالی‌که در زمان 72 ساعت، میزان بیان نسبی این ژن به 97/8 برابر رسید. 48 ساعت پس از اعمال محرک، بیان نسبی ژنT6ODM  83/22 برابر افزایش داشت، درحالی‌که در زمان 72 ساعت، میزان بیان نسبی این ژن  به 45/0 برابر رسید (شکل4).

اثر محرک گرافن به همراه نانوذره نقره گیاهی

نتایج نشان داد که پس از گذشت 48 ساعت از اعمال محرک، بیان ژن DBOX ، 82/3 برابر افزایش یافت، درحالی‌که در زمان 72 ساعت، میزان بیان نسبی این ژن به 31/3 برابر رسید. بیان ژن COR پس از گذشت 48 ساعت از اعمال محرک، 63/50 برابر بیان افزایش داشت، درحالی‌که در زمان 72 ساعت، میزان بیان نسبی این ژن به 75/1 برابر رسید. پس از گذشت 48 ساعت از اعمال محرک، بیان ژن T6ODM 77/45 برابر شد، درحالی‌که در زمان 72 ساعت، میزان بیان نسبی این ژن  به 61/1 برابر رسید (شکل 5).

 

 

 

شکل3ـ اثر محرک گرافن با پوشش نانوذره نقره بر بیان نسبی ژن­های COR ، DBOX  و  T6ODMدر زمان 48 و 72 ساعت برای کالوس­های به‌دست آمده از گیاه P. orientale

Figure 3. Effect of graphene coated with chemical silver nanoparticles on COR, DBOX, and T6ODM gene expressions in P. orientale L. suspension culture.

 

شکل4- اثر نانولوله­های کربنی بر بیان ژن­های COR ، DBOX  و T6ODM در زمان 48 و 72 ساعت برای کالوس­های به‌دست آمده از گیاه P. orientale

Figure 4. Effect of carbon nanotubes on COR, DBOX and T6ODM gene expressions in P. orientale L. suspension culture.

 

 

 

نتایج حاصل از این پژوهش حاکی از آن است که نانومحرک­های مختلف، اثرات متفاوتی در بیان ژن­های دخیل در مسیر تولید آلکالوئیدهای مختلف در کشت دروایه یاخته­ای گیاه شقایق شرقی دارد. همچنین میزان بیان نسبی ژن­های اندازه­گیری شده در نانومحرک نقره گیاهی و شیمیایی پس از 72 ساعت، افزایش داشته است، درحالی‌که در نانومحرک­های کربنی مانند گرافن با پوشش نانوذره نقره، نانو لوله­های کربنی و همچنین ترکیب گرافن به همراه نانوذرات نقره گیاهی، پس از 48 ساعت، علاوه بر کنترل نسبت به زمان 72 ساعت، بیان ژن‌ها افزایش یافت. این موضوع را می­توان با اثر سمیت بیشتر نانوذرات کربنی بر شاخص میتوزی و ژنومی مرتبط دانست (Castiglione et al., 2010). از آن‌جا که اطلاعات زیادی در مورد استفاده از نانوذرات در گیاهان موجود نمی­باشد، تصمیم­گیری در مورد عملکرد آن‌ها در سلول­های گیاهی، نیازمند مطالعات بیشتری است. کاربرد نانوذرات ممکن است سبب بروز استرس­های اکسیداتیو شوند و با آزادسازی رادیکال­های اکسیژن، خسارت­هایی را به مولکول­های زیستی وارد سازند؛ همچنین خود این ذرات نیز یون­هایی را به محیط وارد می­کنند (Chomoucka et al., 2010). نانو نقره، فعالیت ضد میکروبی دارد. گرچه سازوکار سمیت این نانوذره بخوبی شناسایی نشده است، اما به نظر می­رسد که این نانوذره، با تولید یون نقره و یا به­صورت نانوذره، بر یاخته تاثیر می­گذارد. یون نقره با اتصال به پروتئین­های سیستئین­دار در غشا، پلاسمایی، منجر به آسیب­های فیزیولوژیکی و بیوشیمیایی غشا و دیواره یاخته ای می­شود (Levine et al., 1994; Gajjar et al., 2009; Ocsoy et al., 2013).

 

 

       
 

48

 
 

72

 

 

 

 

شکل5- اثر محرک گرافن به همراه نانوذره نقره گیاهی بر بیان ژن­هایCOR ، DBOX  وT6ODM   در زمان 48 و 72 ساعت برای کالوس­های به‌دست آمده از گیاه P. orientale

Figure 5. Effect of graphene and green silver nanoparticles combination on COR, DBOX and T6ODM gene expressions in P. orientale L. suspension culture.

 

 

ژن DBOX  در مسیر زیست ساخت تولید پاپاورین و سنگوئینارین شناخته شده است (Beaudoin & Facchini, 2014). سنگوئینارین دارای خاصیت آنتی اکسیدانتی، ضدمیکروبی و ضد التهابی است (Young Cho et al., 2008). نسخه­های DBOX به‌طور انحصاری در ریشه­های خشخاش بیان می شوند که امکان انتقال سیستماتیک پاپاورین را از ریشه به اندام­های هوایی می­دهد (Beaudoin & Facchini, 2014). این ژن، مسئول تنظیم آستانه تحمل سمیت سنگوئینارین در سلول است. آنزیم دی­هیدروبنزوفنانتریدین اکسیداز، تبدیل دی­هیدروسنگوئینارین به سنگوئینارین را بر عهده دارد که با افزایش سنگوئینارین در سلول، بیان این ژن کاهش می‌یابد تا سلول­ها را از سمیت این ماده دور نگه دارد (Cho et al., 2008). در مطالعه‌بیان نسبی ژن DBOX و آلکالوئید متناظر آن، پاپاورین با محرک نانوذره نقره افزایش پیدا کرد (Shirvani & Naghavi, 2017). این نتیجه، به معنای همبستگی مثبت بین ژنDBOX  و آلکالوئید متناظر آن است. همچنین Cho et al. (2008)، بیان داشتند که با افزایش سنگوئینارین در سلول، بیان این ژن کاهش پیدا می­کند تا سلول ها را از سمیت دورنگه دارد. از آن‌جا که سنگوئینارین جزو ترکیبات بسیار سمی در میان بنزوفنانتریدین­هاست، تجمع آن به‌طور موقت و با تغییر سریع انجام می­پذیرد و زمانی که الیسیتور به محیط سلولی اضافه می­شود، سنگوئینارین افزایش می‌یابد و با ترشح به محیط کشت سلولی، موجب افزایش دی­هیدروسنگوئینارین در سلول می­شود. بنابراین و با توجه به این‌که در این تحقیق، متابولیت­ها اندازه­گیری نشدند، می­توان با استناد به تحقیقات پیشین این‌گونه پنداشت که محرک گرافن با پوشش نانوذره نقره، برای بهره­برداری بیشتر از این متابولیت در شرایط in vitro کارایی بیشتری داشته باشد.

COR ، آنزیم پیشین مسیر مورفین است که کدئینون را به کدئین تبدیل می­کند (Huang
& Kutchan, 2000). این آنزیم همچنین در مسیر دیگری، مورفینان را به مورفین تبدیل می­کند (Beaudoin & Facchini, 2014). در این تحقیق، از بین محرک‌های مختلف، محرک نانوذره GO با پوشش نانوذره نقره و همچنین GO به همراه نانوذره نقره گیاهی، هر دو باعث افزایش بیشتر بیان نسبی ژن در زمان 48 پس از اعمال محرک شدند. نتایج مطالعه‌ Allen et al. (2008)  نشان داد که افزایش ژن COR  می­تواند میزان تجمع کدئین و مورفین را افزایش دهد. بنابراین و با توجه به این‌که افزایش فعالیت این ژن، باعث افزایش این متابولیت ها می­شود، می­توان GO با پوشش نانوذره نقره را پیشنهاد نمود؛ البته با توجه به این‌که نانوذره گیاهی در مقایسه با نانوذره شیمیایی از لحاظ زیست محیطی مطلوب تر است، بنابراین بهتر است GO و Ag گیاهی در مطالعات بعدی استفاده شوند.

ژن T6ODM یکی از ژن­های کلیدی در زیست ساخت مورفین است (Beaudoin & Facchini, 2014). آنزیم T6ODM، تبائین تولید شده را در فرآیند یک واکنش سریع به کدئینون تبدیل می­کند و سپس کدئینون توسط COR به کدئین تبدیل می­شود. این دو آنزیم در مسیر دیگری که از تبائین انشعاب گرفته و اوریپاوین را به مورفین تبدیل می­کند نیز نقش دارند (Beaudoin & Facchini, 2014). Hegal & Facchini (2010)، با خاموش سازی دو ژن T6ODM  و CODM مشاهده کردند که خاموش سازی ژن T6ODM منجر به کاهش میزان مورفین و کدئین می شود. در ژن T6ODM، ترکیب GO با نانوذره گیاهی در زمان 48 ساعتT بهترین حالت بود و بنابراین با توجه به این‌که T6ODM  مشابه با COR  کدئین و مورفین را کنترل می­کند و برایCOR  هم GO همراه با نانوذره نقره گیاهی پیشنهاد شده بود، در اینجا نیز ترکیب GO همراه با نانوذره نقره گیاهی، به‌عنوان مناسب­ترین گزینه پیشنهادی می­تواند برای تحقیقات بعدی به‌کار گرفته شود.

 

نتیجه­گیری کلی

نتایج به‌دست آمده در این تحقیق نشان می­دهد که احتمالا ژن­های DBOX، T6ODM و COR و آلکالوئیدهای متناظر آن­، در تیمار با محرک گرافن با پوشش نانوذره نقره شیمیایی برای بهره­برداری بیشتر از این متابولیت­ها در شرایط in vitro کارایی بیشتری داشته باشد. البته با توجه به این‌که نانوذره نقره گیاهی در مقایسه با نانوذره نقره شیمیایی از لحاظ زیست محیطی مطلوب­تر است، بنابراین بهتر است GO با Ag گیاهی مورد استفاده قرار گیرد. اگر چه در تحقیق حاضر بهتر بود بررسی بیان ژن به همراه ثبت ترکیباتی مانند مورفین، کدئین، تبائین و سنگوئینارین با دستگاه HPLC در تیمارهای مختلف الیسیتوری انجام می گرفت تا مقایسه بین تغییرات در میزان ترکیبات مذکور با بیان ژن‌های دخیل بررسی شود، ولی به واسط کم بودن میزان سوسپانسیون سلولی برای هر تیمار، امکان هر دو مورد ثبت ترکیبات به همراه استخراج RNA و بررسی بیان ژن وجود نداشت.

 

REFERENCES

  1. Allen, R. S., Miller, J. A., Chitty, J. A., Fist, A. J., Gerlach, W. L. & Larkin, P. J. (2008). Metabolic engineering of morphinan alkaloids by over‐expression and RNAi suppression of salutaridinol 7‐O‐acetyltransferase in opium poppy. Plant Biotechnology Journal, 6(1), 22-30.
  2. Beaudoin, G. A. & Facchini, P. J. (2014). Benzylisoquinoline alkaloid biosynthesis in opium poppy. Planta, 240(1), 19-32.
  3. Castiglione, M. R., Giorgetti, L., Geri, C. & Cremonini, R. (2011). The effects of nano-TiO 2 on seed germination, development and mitosis of root tip cells of Vicia narbonensis and Zea mays L. Journal of Nanoparticle Research, 13(6), 2443-2449.
  4. Cho, H. Y., Son, S. Y., Rhee, H. S., Yoon, S. Y. H., Lee-Parsons, C. W. & Park, J. M. (2008). Synergistic effects of sequential treatment with methyl jasmonate, salicylic acid and yeast extract on benzophenanthridine alkaloid accumulation and protein expression in Eschscholtzia californica suspension cultures. Journal of Biotechnology, 135(1), 117-122.
  5. Chomoucka, J., Drbohlavova, J., Huska, D., Adam, V., Kizek, R. & Hubalek, J. (2010). Magnetic nanoparticles and targeted drug delivering. Pharmacological Research, 62(2), 144-149.
  6. Gajjar, P., Pettee, B., Britt, D. W., Huang, W., Johnson, W. P. & Anderson, A. J. (2009). Antimicrobial activities of commercial nanoparticles against an environmental soil microbe, Pseudomonas putida Journal of Biological Engineering, 3(1), 9.
  7. Ghorbanpour, M. & Hadian, J. (2015). Multi-walled carbon nanotubes stimulate callus induction, secondary metabolites biosynthesis and antioxidant capacity in medicinal plant Satureja khuzestanica grown in vitro. Carbon, 94, 749-759.
  8. Goudarzi, M., Mir, N., Mousavi-Kamazani, M., Bagheri, S. & Salavati-Niasari, M. (2016). Biosynthesis and characterization of silver nanoparticles prepared from two novel natural precursors by facile thermal decomposition methods. Scientific Reports, 6, 32539.
  9. Hashemi, S. M., & Naghavi, M. R. (2016). Production and gene expression of morphinan alkaloids in hairy root culture of Papaver orientale using abiotic elicitors. Plant Cell, Tissue and Organ Culture (PCTOC)125(1), 31-41.
  10. Hagel, J. M. & Facchini, P. J. (2010). Dioxygenases catalyze the O-demethylation steps of morphine biosynthesis in opium poppy. Nature Chemical Biology, 6(4), 273-5.
  11. Huang, F. C. & Kutchan, T. M. (2000). Distribution of morphinan and benzo [c] phenanthridine alkaloid gene transcript accumulation in Papaver somniferum. Phytochemistry, 53(5), 555-564.
  12. Lahiani, M. H., Dervishi, E., Ivanov, I., Chen, J. & Khodakovskaya, M. (2016). Comparative study of plant responses to carbon-based nanomaterials with different morphologies. Nanotechnology, 27(26), 265102. Chicago.
  13. Lee, H., Bae, E. K., Park, S. Y., Sjödin, A., Lee, J. S., Noh, E. W. & Jansson, S. (2007). Growth‐phase‐dependent gene expression profiling of poplar (Populus alba × Populus tremula glandulosa) suspension cells. Physiologia Plantarum131(4), 599-613.
  14. Levine, A., Tenhaken, R., Dixon, R. & Lamb, C. (1994). H2O2 from the oxidative burst orchestrates the plant hypersensitive disease resistance response. Cell, 79(4), 583-593.
  15. Namdeo, A. G. (2007). Plant cell elicitation for production of secondary metabolites: A review. Pharmacogn Review, 1(1), 69-79.
  16. Nyman, U. & Bruhn, J. G. (1979). Papaver bracteatum–a summary of current knowledge. Planta Medica, 35(02), 97-117.
  17. Ocsoy, I., Paret, M. L., Ocsoy, M. A., Kunwar, S., Chen, T., You, M. & Tan, W. (2013). Nanotechnology in plant disease management: DNA-directed silver nanoparticles on graphene oxide as an antibacterial against Xanthomonas perforans. Acs Nano, 7(10), 8972-8980.
  18. Shafiee, A., Lalezari, I., Nasseri Nouri, P. & Asgharian, R. (1975). Alkaloids of Papaver orientale and Papaver pseudo orientaleJournal of Pharmaceutical Sciences, 64(9), 1570-1572.
  19. Shirvani, S. & Naghavi, M. (2017). Effect of nano elicitors on alkaloids production and genes expression in Papaver orientale suspension culture. Iranian Journal of field Crop Science. 48(3), 625-636. (in Persian).
  20. Suzuki, K., Fukuda, Y. & Shinshi, H. (1995). Studies on elicitor-signal transduction leading to differential expression of defense genes in cultured tobacco cells. Plant and Cell Physiology, 36(2), 281-289.
  21. Verma, N. & Shukla, S. (2015). Impact of various factors responsible for fluctuation in plant secondary metabolites. Journal of Applied Research on Medicinal and Aromatic Plants, 2(4), 105-113.
  22. Zhao, J., Davis, L. C. & Verpoorte, R. (2005). Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnology Advances, 23(4), 283-333.

 

[1] Oxytona

[2] Suspension

[3] Elicitation

[4] multi-walled carbon nanotubes (MWCNTs)

[5] Green synthesis of silver nanoparticles