بررسی مقدار اینولین و بیان ژن‌های دخیل در بیوسنتز اینولین در ریشه و کشت سوسپانسیون سلولی کاسنی (Cichorium intybus L.)

نوع مقاله : مقاله پژوهشی

نویسندگان

1 گروه زراعت و اصلاح نباتات، دانشکده کشاورزی و منابع طبیعی، دانشگاه تهران، کرج، ایران

2 گروه زراعت و اصالح نباتات، پردیس کشاورزی و منابع طبیعی دانشگاه تهران، کرج، ایران

3 گروه فارماکوگنوزی، دانشگاه علوم پزشکی البرز، کرج، ایران

چکیده

کشت‌های سوسپانسیون سلولی به‌عنوان یک فن کشت درون شیشه‌ای، به‌طور گسترده‌ای در گیاهانبرای تولید متابولیت‌های اولیه و ثانویه استفاده می‌شوند. فروکتان‌ها یکی از متابولیت‌های گیاهی هستند که به مقدار زیاد در خانواده کلاهپرک‌سانان، به‌خصوص در ریشه‌ی کاسنی ذخیره می‌شوند. در این پژوهش، مقدارگلوکز، فروکتوز، ساکارز، 1-کتوز، نیستوز، اینولین، میانگین درجه‌ پلی‌مریزاسیون آن و بیان ژن‌های درگیر در تولید اینولین (1-SST، 1-FFT، 1-FEHIو1-FEHII) در ریشه و کشت سوسپانسیون سلولی کاسنی بررسی شدند. نتایج نشان داد که مقدار و میانگین درجه پلی‌مریزاسیون اینولین در سوسپانسیون سلولی، کمتر از ریشه است. تجزیه‌واکنش زنجیره ای پلیمراز در زمان واقعی (qRT-PCR) نشان داد که بیان ژن 1-FFT در سوسپانسیون سلولی نسبت به ریشه­ گیاه، به‌طور معناداری کاهش‌یافته است. برای سایر ژن‌ها، تفاوت معنی­داری بین ریشه و سوسپانسیون سلولی مشاهده نشد. مقادیر بالای گلوکز و فروکتوز در سوسپانسیون سلولی نشان­دهنده­ فعالیت آنزیم­های تجزیه کننده­ فروکتان (1-FEHI و 1-FEHII) است. بنابراین مقدار و میانگین درجه پلی‌مریزاسیون کمتر اینولین در سوسپانسیون سلولی می‌تواند ناشی از بیان کم ژن 1-FFT و افزایش فعالیت ژن­های 1-FEH باشد. نتایج این پژوهش نشان داد که اگرچه مقدار اینولین در سوسپانسیون سلولی کمتر از ریشه است، اما کشت­های سوسپانسیون سلولی، از قابلیت تولید اینولین را در مدت زمان کوتاه دارا برخوردارند. 

کلیدواژه‌ها


عنوان مقاله [English]

Inulin content and expression of the genes involved in inulin biosynthesis in root and cell suspension culture of Chicory (Cichorium intybus L.)

نویسندگان [English]

  • Fatemeh Mohammadi 1
  • MohammadReza Naghavi 2
  • Seyed Ali Peighambari 2
  • Nafiseh Khosravi Dehaghi 3
1 Department of Agronomy and Plant Breeding, Agricultural and Natural Resources College, University of Tehran, Karaj, Iran
2 Department of Agronomy and Plant Breeding, University College of Agriculture & Natural Resources, University of Tehran, Karaj, Iran
3 Department of Pharmacognosy,Alborz University of Medical sciences,Karaj,Iran
چکیده [English]

Plant cell suspension cultures are widely used as an in vitro culture technique for primary and secondary metabolites production. Fructans are one of the herbal metabolites that considerably accumulate in the Asteraceae family, especially in chicory root. In this study, the amount of glucose, fructose, sucrose, 1-kestose, nystose, inulin, mean degree of polymerization (mDP) of inulin and expression of genes involved in inulin biosynthesis (1-SST, 1-FFT, 1-FEHI, and 1-FEHII) were investigated in the roots and the cell suspension cultures of chicory. The results showed that inulin quantity and the mDP of inulin in cell suspension cultures are less than roots. Quantitative Real-time Polymerase Chain Reaction (qRT-PCR) analysis showed that the gene expression of 1-FFT was significantly down-regulated in the cell suspension cultures compared to the root. For other genes, no significant differences were detected between the roots and cell suspension cultures. High quantity of fructose and glucose in cell suspension culture indicates the high activity of fructan hydrolyzed enzymes (FEHI and 1-FEHII), therefore, lower inulin content and mean degree of polymerization could be due to low expression of 1-FFT gene and high activity of 1-FEHs. The results showed that the quantity of inulin in cell suspension culture is lower than roots, but cell suspension cultures have desirable capabilities in inulin production in a short time.

کلیدواژه‌ها [English]

  • Inulin
  • cell suspension culture
  • mean degree of polymerization
  • Cichorium intybus
  • qRT-PCR

مقدمه


کاسنی (L. Cichorium intybus) اصلی‌ترین گیاه برای استخراج صنعتی فروکتان در کشورهای توسعه‌یافته است. نوع اینولین فروکتان، به‌عنوان یک ترکیب پری بیوتیک، به‌وفور در ریشه کاسنی (تقریباً 80 درصد وزن خشک) تجمع می‌یابد
(Baert et al., 1993). فروکتان­ها، کربوهیدرات ذخیره‌ای هستند که در 15 درصد از گونه‌های گل‌دار وجود دارند (Hendry, 1993) و گیاه از آن‌ها برای پر شدن دانه و رشد مجدد، عوامل محافظ در برابر تنش سرما و خشکسالی از طریق تثبیت غشاء و تنظیم‌کننده‌های اسمزی در طول باز شدن گل استفاده می‌کند و علاوه براین، فروکتان نوع اینولین، به‌عنوان ترکیب غذایی عملگرا اهمیت دارد
(Valluru et al., 2008). اینولین، پلیمری خطی از فروکتوز با پیوند β(2→1) است که به یک گلوکز که با پیوند α(1→2) به فروکتوز متصل است، ختم می‌شوند. درجه پلیمریزاسیون (DP) اینولین بین دو تا 60 است. اینولین با درجه پلیمریزاسیون پایین، برای تولید فروکتوالیگوساکارید[1] و اینولین با درجه پلیمریزاسیون بالا، برای کاربردهای غذا دارویی مفیداست (Saengkanuk et al., 2011). ذخیره کربوهیدرات به شکل فروکتان در ریشه و ساقه گیاهان دولپه مانند کاسنی، سیب زمینی‌ترشی و قاصدک و در تک‌لپه‌ای غیر گرامینه­ای مانند مارچوبه و آگاو و در گونه‌های گرامینه مانند گندم و جو گزارش شده است (Cairns, 2003; Avila et al., 2015).

اینولین به وسیله‌ دو آنزیم، ساکارز یعنی ساکارز 1- فروکتوترانسفراز (1-SST, EC 2.4.1.99) و فروکتان: فروکتان 1- فروکتوسیل ترانسفراز (1-FFT, EC 2.4.1.100) تولید می‌شود. در مرحله‌ شروع، آنزیم ساکارز 1- فروکتوترانسفراز، یک واحد فروکتوز را از یک مولکول ساکارز به مولکول ساکارز دیگر به عنوان پذیرنده واحدهای فروکتوز منتقل می‌کند تا 1- کتوز (که کوچکترین مولکول فروکتان) و یک گلوکز آزاد بوجود آید. در مرحله‌ طویل شدن، تری ساکارید 1- کتوز با فعالیت آنزیم فروکتان یعنی فروکتان 1- فروکتوسیل ترانسفراز، طویل شدن زنجیره را به‌وسیله 1-کتوز یا فروکتان‌هایی با درجه پلی مریزاسیون بیشتر فرآهم می‌آورد (Van Laere & Van Den Ende, 2002). تجزیه اینولین با فعالیت آنزیم فروکتان 1- هیدرولاز انجام می‌شود که در نتیجه‌ی آن فروکتوز آزاد تولید می‌شود (Peukert et al., 2014).

مطالعات بسیاری در مزرعه و گلخانه روی کاسنی انجام شده است. اثرات تغییر فصل روی مقدار اینولین، درجه پلیمریزاسیون، بیان ژن‌های مسیر بیوسنتز اینولین و ارتباط آن‌ها با تاریخ برداشت بررسی شده است (Van Arkel et al., 2012) و همچنین اثرات تش‌های محیطی مانند خشکی
 De Roover et al., 2000))، سرماWei et al., 2016)) و کمبود نیتروژن (Kusch et al., 2009) نیز مورد بررسی قرار گرفته است. تاریخ مطلوب برداشت، بر اساس عملکرد ریشه و درجه پلی مریزاسیون تعیین می‌شود (Wilson et al., 2004). در شرایط عادی مزرعه، در انتهای فصل رشد و به دلیل وقوع سرما، کیفیت اینولین (درجه پلیمریزاسیون اینولین: تعداد واحدهای فروکتوز متصل به زنجیره) افت می‌کند و به‌زیر 25 می‌رسد که علت اصلی آن، فعالیت زیاد آنزیم‌های 1-FFT و 1-FEH است
(Van Arkel et al., 2012). از آن‌جا که تولید فروکتان، به تغییرات محیطی وابسته است و عوامل محیطی می‌توانند تولید آن را تحت تأثیر قرار دهند، بنابراین استفاده از روش‌های جایگزین مانند کشت‌های درون شیشه‌ای برای تکثیر گیاه و تولید فروکتان، مطلوب به‌نظر می‌رسد.

کشت‌های درون شیشه‌ای، یک مدل خوب برای بررسی و افزایش تولید متابولیت‌های مختلف هستند زیرا به‌راحتی می‌توان ترکیبات محیط کشت، نور و دما را تغییر داد. کشت‌های سلولی تمایزنیافته (کالوس و سوسپانسیون سلولی)، اغلب به‌دلیل انعطاف پذیری بالایی و هترتروف بودن،  استفاده می‌شوند Mulabagal & Tsay, 2004)). حضور اینولین در بافت‌های کشت شده در شرایط درون شیشه‌ای در کاسنی(Kumari et al., 2007) و سایر گیاهان ذخیره‌کننده فروکتان و در کالوس‌های گیاهانی مانند Phleum pratense L. (Poaceae) (Hale et al., 1987)، Symphytum officinale L. (Boraginaceae)، Vernonia herbacea (Trevisan et al., 2014) و در کالوس و ریشه‌های غده‌ای Viguiera discolor Baker (Asteraceae) (Itaya et al., 2005) گزارش شده است.  بنابراین کالوس‌ها توانایی تولید متابولیت‌های ثانویه را دارا هستند و اغلب از این جهت، قابل مقایسه با گیاه اصلی می باشند) Parsaeimehr et al., 2010; Molchan et al., 2012). با توجه به قابلیت کشت­های درون شیشه­ای در تولید متابولیت­ها و عدم بررسی تولید فروکتان درکشت­های سوسپانسیون سلولی، هدف از این تحقیق، بررسی تولید فروکتان در کشت سوسپانسیون گیاه کاسنی به عنوان گیاه مدل در بررسی فروکتان‌ها و مقایسه مقادیر آن با ریشه‌ گیاهانی بود که در شرایط کنترل شده گلخانه کشت شده‌اند

 

مواد و روش‌ها

آزمایشات گلخانه‌ای

بذرهای گیاه کاسنی Cichorium inybus L. در قالب طرح آماری کامل تصادفی با سه تکرار، در گلخانه­ تحقیقاتی دانشکده کشاورزی دانشگاه تهران در کرج، با موقعیت 35 درجه عرض شمالی، 50 درجه شرقی در دمای 25 درجه سانتی­گراد و شرایط نوری 16 ساعت روشنایی و هشت ساعت تاریکی کشت شدند. جهت اندازه‌گیری مقدار کربوهیدرات‌ها، نمونه‌برداری از ریشه گیاه در مرحله‌ رویشی در سه مرحله (5/2 و 6 ماه پس از کشت و انتهای روزت) انجام شد و برای بررسی بیان ژن (برای نرمال‌سازی)، قسمت‌هایی از ریشه‌های گیاه 75 روزه، فوراً در ازت مایع فریز شدند و سپس در فریزر 70- نگه­داری شدند. در هر مرحله نمونهگیری، سه بوته بصورت تصادفی انتخاب شد
 (van Arkel et al., 2012).

کالوس‌زایی و سوسپانسیون سلولی

برای ایجاد گیاه استریل، بعد از شست‌وشوی اولیه بذرها با آب مقطر، ضدعفونی بذرها با الکل 70 درصد و هیپوکلرید پج درصد، به ترتیب به مدت پنج ثانیه و 20 دقیقه انجام شد و سپس بذرها چندین مرتبه آب مقطراستریل شست وشو شدند. بذرهای ضدعفونی شده در شیشه‌های کشت حاوی محیط کشت MS2/1 دارای 30 و هفت گرم بر لیتر، به‌ترتیب ساکارز و آگارکشت شدند و به اتاق کشت با دمای 23 درجه سانتی‌گراد و تناوب نوری 16 ساعت روشنایی و هشت ساعت تاریکی استفاده شد. بعد از چهار هفته، کوتیلدون و برگ‌های کاسنی در محیط کشت MS حاوی 30 گرم بر لیتر ساکارز و هفت گرم بر لیتر آگار به همراه تیمارهای هورمونی متفاوت درون پتری دیش‌ها کشت شدند. جهت انتخاب بهترین محیط کالوس‌زایی، سه سطحBA  (5/0، یک و 5/1) (Al Khateeb et al., 2012) و سه سطح NAA (3/0، 5/0 و یک) بررسی شدند (جدول 1) و محیط دارای بالاترین درصد کالزایی برای آزمایشات بعدی انتخاب شد.

 

 

جدول 1- درصد تولید کالوس در تیمارهای هورمونی متفاوت.

Table 1. Callus production percentage in different hormone treatments.

 

NAA

 

 

 

1

0.5

0.3

 

 

10%

necrosis

40%

0.5

 

50%

necrosis

30%

1

BAP

necrosis

90%

5%

1.5

 

 

 

ریزنمونه‌های برگ در محیط منتخب کشت داده شدند (شکل 1) و از کالوس‌های حاصل از دو واکشت با فاصله‌ 21 روز، برای تهیه‌ سوسپانسیون سلولی استفاده شد. برای تهیه‌ سوسپانسیون سلولی، در ارلن 100 میلی‌لیتر، یک گرم کالوس به 40 میلی‌لیتر محیط مشابه با کالزایی اما بدون اگارا افزوده شد(Al Khateeb et al., 2012). ارلن‌ها به شیکر انکوباتورتاریک با دمای 25 درجه سانتی‌گراد و سرعت گردش 120 دور در دقیقه منتقل شدند و منحنی رشد کالوس‌ها در بازه‌ 26 روزه محاسبه شد و بر اساس آن، نمونه برداری در روز 18، قبل از ورود به فاز ایستایی انجام شد (شکل 2)؛ سپس کالوس‌ها از سوسپانسیون سلولی جدا شدند.

 

 

 

شکل 1- کالوس و سوسپانسیون سلولی کاسنی.

Figure1. Callus and suspension culture of chicory.

 

شکل 2- منحنی رشد کالوس.

Figure 2. Callus growth Curve.

 

 

استخراج و اندازه‌گیری کربوهیدرات‌ها

ریشه‌های گیاه در سه مرحله و همچنین کالوس های جداسازی شده از سوسپانسیون سلولی با دستگاه فریز درای، خشک و پودر شدند. برای استخراج کربوهیدرات‌ها، از روش (2008) Raessler et al.  با اندکی تغییرات استفاده شد.

از دستگاه کروماتوگرافی مایع با عملکرد بالا متصل به آشکار ساز ELSD مدل  C-650ساخت  شرکت BUCHI، واقع در دانشگاه پروجا ایتالیا، استفاده شد. 10 میکرولیتر عصاره استخراجی به ستونی با مشخصات Shodex Asahipac NH2P-50، به طول 250 میلی‌متر و قطر دخلی 5/4 میلی‌متر با قطر ذرات پنج میکرومتر و در حرارت 60 درجه سانتی‌گراد ترزیق شد. حلال شست و شو شامل 75% استونیتریل و 25% آب خالص بود که به صورت گرادیانت (صفر-10 دقیقه: 75:25، 10-25: 50:50، 25-30:50-50، 30-35: 75-25) اعمال شدند و سرعت شست و شو، یک میلی‌متر در دقیقه بود. پیک‌های خروجی بر اساس زمان بازداری با نمونه‌های استاندارد گلوکز، فروکتوز، ساکارز، کتوز و نیستوز شرکت سیگما تعیین شد (شکل 3). نتایج به‌دست آمده و اطلاعات مربوط به سطح زیر منحنی‌های نمونه و زمان بازداری هر یک، با کمک نرم افزار Clarity ver. 3.0.5.505 ثبت شد (شکل 4) و غلظت فروکتوز، ساکاروز و گلوکز موجود در هر عصاره با توجه به منحنی استاندارد و زمان بازداری، محاسبه شد. برای اندازه گیری مقدار اینولین از روش تجزیه اسیدی Maicaurkaew et al. (2017) استفاده شد.

 

 

 

 

شکل 3- منحنی­های استاندارد HPLC.

Figure 3. HPLC standard curves.

 

 

بیان ژن‌های مسیر سنتز اینولین در سطح رونوشت

ریبونوکلئیک اسید کل از کالوس‌های استخراج شده از سوسپانسیون سلولی و ریشه‌های گیاه 75 روزه، با استفاده از کیت بایوزول (BIOFLUX) استخراج شد(Khaldari et al.,2018). به منظور اطمینان از کیفیت RNA استخراج شده، جذب نمونه‌ها در طول موج­های 260 و 280 نانومتر با استفاده از دستگاه نانودراپ خوانده شد. همچنین کیفیت RNA ها با الکتروفورز ژلی بررسی شد. پس از اطمینان از کیفیت،RNA ها با آنزیم  DNase (Fermentase, Waltham, Massachusetts, USA) تیمار شدند و سپس با غلظت­های مشخص، جهت سنتزcDNAمورد استفاده قرار گرفتند. سنتز cDNA با استفاده از کیت Takara  انجام شد. cDNA آماده شده برای آزمون پرایمرها و Realtime PCR استفاده شد.

 

 

 

شکل 4- کروماتوگرام HPLC سوسپانسیون سلولی.

Figure 4. HPLC chromatogram of cell suspension culture.

 

 

طراحی جفت آغازگرها با استفاده از برنامه پرایمر سه انجام گرفت و سپس پرایمرهای طراحی شده توسط نرم افزارهای الیگوکلک و الیگو آنالیزر، از لحاظ احتمال وقوع دایمر بررسی شدند. جفت آغازگرها برای چهار ژن1-SST، 1-FFT، 1-FEHI، 1-FEHII و همچنین ژن RPL19 به عنوان ژن خانه دار استفاده شدند (جدول 2).

 

 

جدول 2- نام و توالی آغازگرهای مورد استفاده برای  qRT-PCR در C. intybus.

Table 2. List of primer used in qRT-PCR in C. intybus.

Primer

 

Sequence

Product size

1-SST

F

GTGGGTCGGCGTTTATCCAT

154

R

ATCTCCGCCCTGATGGTTGT

 

1-FFT

F

AATGTTGGAGGAGCCGTTGC

191

R

CGCGATATCAAGTGCGCTGT

 

1-FEH 1

F

AGCATCTACGGAGCTTTTCTTG

147

R

CTTCTCCAAAACTTTCGAC

 

1-FEH II

F

CCCGACCCAAGAAGCTGACA

185

R

CTTTGAATCGCTGCCGGTGT

 

RPL19

F

CTGCCAGCGTCCTCAAGTG

 

51

R

CATTGGGATCAAGCCAAACCT

 

 

RPL19: ژن رفرنس معتبر در کاسنی Wei et al., 2010; van Arkel et al., 2012)).

RPL19: Valid chicory reference gene )Wei  et al., 2010 ; van Arkel et al., 2012).

 

 

واکنش ریل تایم پی سی آر در سه تکرار با EvaGreen  (Solis BioDyn, Germany)، با استفاده از دستگاه Rotor gene-Q شرکت Qiagene صورت گرفت. مخلوط واکنش شامل چهار میکرولیترcDNA ، 5/0میکرولیتر از هر پرایمر، هشت میکرولیتر  EvaGreen و هفت میکرولیتر آب بود. برنامه واکنش شامل دمای 95 درجه سانتی‌گراد به مدت یک دقیقه و سپس طی 40 سیکل با  دمای 95 درجه برای 30 ثانیه، 55 تا 59 درجه برای 20 ثانیه و 72 درجه برای 20 ثانیه بود.

Ratio= (Etarget) ΔCP target (Control-Sample) / (Eref) ΔCPreft (Control-Sample)

منحنی­های ذوب هر پرایمر، نشان دهنده­ تکثیر اختصاصی بود (شکل 5). بر اساس این فرمول، نسبت تظاهر ژن هدف بر اساس راندمان تکثیر واکنش زنجیره‌ای پلی مراز (E) و تفاوت نقطه تقاطع (Δ) نمونه ناشناخته نسبت به شاهد محاسبه می‌شود. داده‌های حاصل از اندازه گیری بیان ژن‌ها، با استفاده از Real time PCR توسط نرم افزار Rest و بر اساس دستور العمل  et al. Pfaffl (2002) برای بدست آوردن بیان نسبی ژن‌ها تجزیه شدند.

 

 

 

شکل 5- منحنی­های ذوب :1-SST (a)، 1-FFT(b)، 1-FEHI(c)، 1-FEHII(d) و RPL 19(e)

Figure5. Melting curves: 1-SST (a), 1-FFT(b), 1-FEHI(c), 1-FEHII(d) and RPL 19(e)

 

 

تجزیه داده‌ها

تجزیه واریانس داده‌ها با نرم افزار آماری SAS نسخه 9.1 انجام شد و جهت رسم نمودارها، از نرم افزار Excel 2007  استفاده شد. تجزیه و تحلیل میانگین داده‌ها نیز با نرم افزار آماری SAS نسخه 9.1 و بر  اساس آزمون چند دامنه ای دانکن در سطح احتمال خطای کوچکتر از پنج درصدمقایسه شدند.

 

نتایجو بحث

تولید کالوس و کشت سوسپانسیون سلولی

اولین نشانه‌های تشکیل کالوس، تقریباً 12 روز بعد از کشت ریزنمونه‌های برگ مشاهده شد. ریزنمونه‌ها بزرگ و زرد کمرنگ شدند و بعد از چهار هفته، درصد تشکیل کالوس‌ها ثبت شد. از بین شش ترکیب هورمونی استفاده شده (جدول 1) و بر اساس درصد کالزایی ترکیب هورمونی به‌ترتیب شامل 5/. و 5/1، NAA و  BA،Pبالاترین درصد کالزایی را نشان داد. گزارشات متفاوتی در مورد القای کالوس در کاسنی وجود دارد. از NAA به عنوان بهترین اکسین برای القای کالوس در ترکیب با BA یاد شده است (Velayutham et al., 2006) و همچنین گزارش شده است که مقادیر بالای NAA (بیش از یک میلی‌گرم بر لیتر)، سرعت تشکیل کالوس را افزایش می‌دهد. بر عکس، استفاده ازIAA ­ در ترکیب با BA یا کینتین برای القای کالوس استفاده شده است که مقادیر بالای IAA (بیش از 2/0 میلی گرم بر لیتر) در ترکیب با BA، تشکیل کالوس را کاهش داده است
 Rehman et al., 2003)). در گونه‌ دیگری از کاسنی، 100 درصد تولید کالوس در محیطی با 5/1 تا دو میلی‌گرم BA بر لیتر و 5/0 میلی‌گرم NAA بر لیتر به‌دست آمده است، در حالی که محیط حاویBA ، پایین‌ترین درصد تشکیل کالوس را نشان داده است (AL Khateeb et al., 2012). منحنی رشد کالوس بر اساس وزن خشک، به‌دست آمد (شکل 1) که قابل تفکیک به سه فاز بود: رشد تاخیری در روزهای اولیه دو-سه، فاز لگاریتمی از روز شش تا 19و بعد از آن فاز ایستایی که بر اساس آن نمونه برداری در روز 18 انجام شد (شکل 2).

تجزیه مقدار کربوهیدرات‌ها

بر اساس نتایج حاصل از تجزیه واریانس، تفاوت معناداری بین بافت­های ریشه و سوسپانسیون سلولی از نظر مقدار کربوهیدرات‌ها وجود داشت(جدول 3).

ریشه گیاه

در مقایسه‌ مراحل مختلف در ریشه‌ گیاه، مقدار فروکتوز بیشتری در مرحله‌ی سوم مشاهده شد
(شکل 1) که می‌تواند ناشی از تجزیه‌ اینولین باشد زیرا با نزدیک شدن گیاه به ساقه دهی، گیاه از ذخایر خود برای رشد و نمو استفاده می‌کند و همان طور که در شکل 3 قابل مشاهد است، در این مرحله، مقدار اینولین و درجه پلیمریزاسیون نسبت به مرحله‌ قبل کاهش یافته است. در شرایطی نظیر کاهش دما
(Van Den Ende et al., 1996) و ورود به فاز زایشی (Roy et al., 2007)، سنتز اینولین کاهش م و سرعت تخریب آن افزایش می‌یابد؛ در چنین شرایطی بیان ژن 1-SST به سرعت کاهش می‌یابد و تعادل بین آنزیم‌های 1-FFT و 1-FEH بر تغییرات طول فروکتان یا درجه پلیمریزاسیون (DP) آن‌ها اثر گذار است (Narai-kanayama et al., 2007).

 

 

جدول 3- تجزیه واریانس محتوای کربوهیدرات­ها در ریشه­ها و سوسپانسیون سلولی کاسنی.

Table 3. Variance analysis of carbohydrates in chicory roots and cell suspension culture.

 

 

S.O.V

df

Mean Square

Fructose

Glucose

Sucrose

1-kestose

Nystose

Inulin

mDP

Tissue

3

3126.64**

894.08**

7490.23**

504.74**

974.32**

4785.98**

157.74**

Error

8

12.67

11.80

17.32

2.14

17.45

21.54

0.64

CV%

 

18.89

37.28

7.41

5.74

19.41

1.15

7.28

 

 

 

** : معنی دار در سطح یک درصد.

**: significant at the 1% of probability levels.

 

 

مقدار گلوکز و ساکارز در مراحل مختلف رشدی تفاوت معناداری نداشتند اما مقادیر کتوز و نیستوز در هر سه مرحله با هم اختلاف معنی داری داشتند. بیشترین مقدار کتوز و نیستوز در مرحله‌ اول مشاهده شد. مقدار بیشتر کتوز در اوایل رشد و روند کاهشی آن، ناشی از کاهش قعالیت آنزیم 1-SST در طول دوره رشد است. در مرحله ابتدایی رشد، فعالیت آنزیم بیوسنتز اینولین (1-SST)، بیشتر از دیگر مراحل است؛ اگرچه رشد ریشه ادامه دارد ولی فعالیت این آنزیم کاهش می‌یابد. در مرحله‌ رویشی در کشت‌های مزرعه‌ای و در شرایط کنترل نیز نتایج مشابهی مشاهده شده است (Van Arkel et al., 2012).

مقدار نیستوز در ریشه‌ها نیز مشابه با مقدار1-کتوز بود. مقدار 1-کتوز در مرحله اول بیشتر از سایر مراحل بود اما با در نظر گرفتن مقدار اینولین و درجه پلی‌مریزاسیون در این مرحله می‌توان نتیجه گرفت که در این مرحله، افزایش مقدار اینولین و افزایش درجه پلی‌مریزاسیون به طور همزمان دنبال می‌شود. مرحله‌ دوم در کاسنی، بیشترین مقدار درجه پلی مریزاسیون و اینولین را داشت و مقدار نیستوز نسبت به مرحله‌ی اول کاهش یافت که ناشی از فعالیت آنزیم 1-FFT در جهت افزایش درجه پلی مریزاسیون است. در واقع در این مرحله، این آنزیم از کتوز و نیستوز در جهت افزایش پلیمریزاسیون سایر اینولین‌ها با درجه پلیمریزاسیون بالاتر استفاده می‌کند
 (van Arkel et al., 2012).

سوسپانسیون سلولی

تجزیه نتایج حاصل از اندازه گیری قندها نشان داد (شکل 6) که سوسپانسیون سلولی نسبت به ریشه‌ گیاه (هر سه مرحله)، دارای مقادیر بیشتری فروکتوز، گلوکز، ساکارز، کتوز و نیستوز است اما مقدار اینولین کمتری در سوسپانسیون سلولی نسبت به ریشه‌ گیاه مشاهده شد؛ همچنین درجه پلی‌مریزاسیون اینولین در سوسپانسیون، کم­تر از ریشه­ها بود (شکل 7).

 

 

 

شکل 6- تغییرات در محتوای گلوکز، فروکتوز، ساکارز، 1- کتوز و نیستوز در ریشه کاسنی ) سه مرحله) و سوسپانسیون سلولی. محور افقی: 1: ریشه‌ 75 روزه، 2: ریشه‌ شش‌ماهه، 3: ریشه در انتهای روزت و 4: کشت سوسپانسیون سلولی. حروف متفاوت بالای ستون­ها، نشان دهنده­ اختلاف آماری معنی دار در سطح پنج درصد  بر اساس آزمون چند دامنه­ی دانکن است.

Figure 6- Changes in fructose, glucose, sucrose, 1-kestose and nystose, in chicory rootsat three stages and cell suspension culture. Horizontal axis: 1:75 days of root, 2: six months root, 3: root at the end of rosette and 4: cell suspension culture. Columns with different letters are significantly different at 5% of probability level, based on Duncan’s multiple range tests.

 

 

اگرچه مقدار اینولین در سوسپانسیون سلولی، کمتر از مقدار آن در ریشه‌ کاسنی بود اما با در نظر گرفتن این موضوع که این مقدار اینولین در کمتر از سی روز به‌دست آمده است، مقدار آن قابل توجه بود. این در حالی است که تولید اینولین در ریشه گیاه کاسنی یک ماه بعد از کشت، یعنی پس از انتقال ساکارز از برگ به ریشه‌ گیاه انجام می‌شود. در این زمان، مقدار ساکارز در ریشه به حد آستانه­ گیاه برای تولید اینولین می­رسد. مقدار بالای اینولین درسوسپانسیون سلولی در این زمان محدود، شاید ناشی از مقدار زیاد ساکارز موجود در محیط کشت می‌باشد زیرا آنزیم‌های بیوسنتز فروکتان از ساکارز، به‌عنوان یک پیش ماده استفاده می‌کنند که به‌موجب آن، مقدار ساکارز در یک سطح آستانه، باعث شروع فعالیت ژن‌های بیوسنتز فروکتان در سطح رونوشت می‌شود (Lu et al., 2002). در واقع غلظت بالای ساکارز، بیان ژن‌های تولید کننده فروکتان را القا می‌کند، درحالی‌که از بیان ژن‌های هیدرولیز کننده جلوگیری می‌کند (lothier et al, 2007). مطالعات قبلی در در شرایط کشت بافت نشان می­دهد که مقدار اینولین در ریشه‌های رشدیافته در شرایط درون شیشه‌ای نسبت به گیاهانی که در شرایط طبیعی رشد کرده‌اند کمتر است Itaya et al., 2005; Kusch et al., 2009).) نتایج نشان می‌دهد که هورمون­ها تاثیر زیادی بر مقدار اینولین در کشت بافت داشته­اند و نسبت اکسین و سیتوکینین استفاده شده روی آنزیم بیوسنتز اینولین تأثیر می‌گذارد. کینتن نیز در افزایش تولید فروکتان در شرایط درون شیشه‌ای اثر گذار بوده است (Suarez-Gonzalez et al., 2014). نتایج کروماتوگرافی در کشت سوسپانسیون سلولی کالوس‌های ورنونیا نیز نشان داده است که نوع کالوس نیز یکی از عوامل تاثیرگذار است، به‌طوری که کالوس‌های فشرده نسبت به کالوس‌های شکننده، دارای اینولین بیشتری هستند و درجه پلی مریزاسیون در کالوس‌های متراکم، سه تا 27 و در کالوس‌های شکننده سه تا 12 بود (Trevisan et al., 2014).

 

 

 

 

شکل 7- تغییرات در مقدار اینولین و میانگین درجه پلی مریزاسیون ریشه کاسنی ) سه مرحله) و در سوسپانسیون سلولی. محور افقی: 1: ریشه‌ 75 روزه، 2: ریشه‌ شش ماهه، 3: ریشه در انتهای روزت و 4: کشت سوسپانسیون سلولی. حروف متفاوت، نشان دهنده­ اختلاف آماری معنی دار در سطح پنج درصد و بر اساس  آزمون چند دامنه­ی دانکن است.

Figure 7. Changes in Inulin and Mdp in chicory root at three stages and cell suspension culture. Horizontal axis: 1:75 days’ root, 2: six months’ root, 3: root at the end of rosette and 4: cell suspension culture. Columns with different letters are significantly different at 5% of probability level, based on Duncan’s multiple range tests.

 


بیان ژن‌های مسیر بیوسنتزی اینولین در سوسپانسیون سلولی

جهت بررسی بیشتر و به‌دست آوردن اطلاعات در مورد تولید اینولین در سوسپانسیون سلولی، بیان ژن‌های مسیر بیوسنتزی اینولین در سوسپانسیون سلولی بررسی شد. با توجه به این‌که ریشه‌ گیاه در مرحله اول از نظر مقدار اینولین و درجه پلی‌مریزاسیون، به سوسپانسیون سلولی نزدیک بود، از بافت ریشه در این مرحله جهت کنترل و بررسی بیان ژن‌ها استفاده شد. نتایج نشان داد که فقط بیان ژن1-FFTدر سوسپانسیون سلولی نسبت به ریشه کاهش یافته است (شکل 8) و در بقیه ژن‌ها، تفاوت معناداری بین سوسپانسیون سلولی و ریشه مشاهده نشد. پایین بودن میانگین درجه پلی‌مریزاسیون در سوسپانسیون سلولی می‌تواند ناشی از بیان کم ژن 1-FFT باشد. بیان کم ژن 1-FFTمی‌تواند به این دلیل باشد که سوسپانسیون سلولی در ابتدای تولید اینولین است، مانند ریشه­ گیاهان که در مراحل ابتدایی، بیان ژن 1-FFT در آن­ها کم است و سپس افزایش می­یابد. در مزرعه، تولید اینولین بعد از یک ماه آغاز می‌شود و بعد از پنج تا شش ماه به حداکثر می‌رسد (van Arkel et al., 2012.). از جهت دیگر، کاهش درجه پلی‌مریزاسیون می‌تواند ناشی از افزایش بیان ژن‌های تجزیه کننده اینولین باشد. اگرچه بیان این ژن­ها در سوسپانسیون سلولی با ریشه تفاوت معنی داری نداشته است اما افزایش فروکتوز و گلوکز در سوسپانسیون سلولی، نشان دهنده­ فعالیت­ آن‌ها در سطح آنزیمی است. به نظر می­رسد که افزایش فعالیت آنزیم­های تجزیه کننده اینولین (1-FEH)، ناشی از کاهش مواد در دسترس باشد زیرا در کشت سوسپانسیون سلولی، به‌دلیل بسته بودن محیط، بعد از مدتی به دلایل مختلف از جمله کمبود مواد غذایی، سلول‌ها وارد فاز ایستایی می‌شوند و تکثیر و رشد سول‌ها متوقف می‌شود. در واقع کمبود مواد غذایی به عنوان یکی از عوامل تنش­زا، سبب فعالیت آنزیم­های تجزیه کننده فروکتان می­شود.

 

 

 

شکل 8- بیان ژن‌های مسیر بیوسنتزی اینولین (1-SST، 1-FFT،1-FEHI و 1-FEHII) در سوسپانسیون سلولی. بیان ژن در ریشه‌های 75 روزه، یک در نظرگرفته شد و بیان هر ژن با توجه به بیان ریشه 75 روزه، نرمال شد. حروف متفاوت نشان دهنده­ اختلاف آماری معنی دار در سطح پنج درصد و بر اساس آزمون دانکن است.

Figure 8. Expression of genes encoding Inulin biosynthesis pathway (1-SST, 1-FFT, 1-FEHIand1-FEHII) in cell suspension. The gene expression in 75 days’ roots was considered one and the expression level of each gene was normalized with respect to this scale. Columns with different letters are significantly different at 5% of probability level, based on Duncan’s multiple range tests.

 

 

نتیجه گیری کلی

 نتایج این پژوهش نشان می‌دهد که سوسپانسیون سلولی، از پتانسیل بالایی تولید برخوردار است و به عنوان کشت سلولی تمایز نیافته، قادر به تولید مقادیر بالایی از اینولین با درجه‌ پلی‌مریزاسیون پایین است. به‌نظر می­رسد که دو مشکل اصلی در برابر افزایش مقادیر اینولین و درجه پلیمریزاسیون آن وجود دارد؛ نخست، بیان کم ژن 1-FFT است زیرا سلول­ها در مرحله­ آغازی تولید اینولین هستند و سپس، فعالیت آنزیم­های تجزیه کننده فروکتان می‌باشد. امروزه جهت تسهیل کشت­های سوسپانسیون سلولی، از بیوراکتورها استفاده می­شود که یکی از مزایای آن، اضافه کردن محیط کشت جدید و از بین بردن محدویت مواد غذایی است که مدت زمان بیشتری را برای رشد به سلول­ها می­دهد. بنابراین با توجه به پتانسیل موجود برای تولید فروکتان­ها، انتظار می­رود با استفاده از بیوراکتورها بتوان مقادیر بیشتری از اینولین را تولید کرد و همچنین میانگین درجه پلی­مریزاسیون­های بالاتری را به‌دست آورد.

 

 

REFERENCES

  1. Avila-de Dios, E., Gomez-Vargas, A. D., Damian-Santos, M. L. & Simpson, J. (2015). New insights into plant glycoside hydrolase family 32 in Agave species. Frontiers in Plant Science, 6, 1-14.
  2. Baert, J. R. A. & Van Bockstaele, E. J. (1992). Cultivation and breeding of root chicory for inulin production. Industrial Crops and Products, 1, 229-234.
  3. De Roover, J., Vandenbranden, K., Van Laere, A. & Van den Ende, W. (2000). Drought induces fructan synthesis and 1-SST (sucrose: sucrose fructosyltransferase) in roots and leaves of chicory seedlings (Cichorium intybus L.). Planta, 210(5), 808-814.
  4. Hendry, G. A. (1993). Evolutionary origins and natural functions of fructans–a climatological, biogeographic and mechanistic appraisal. New Phytologist, 123(1), 3-14.
  5. Kumari, B., Velayutham, P. & Anitha, S. (2007). Comparitive study on inulin and esculin content of in vitro and in vivo plants of Chicory (Cichorium intybus L. Cv. Lucknow Local). Advances in Biological Research, 1 (1-2): 22-25.
  6. Kusch, U., Greiner, S., Steininger, H., Meyer, A. D., Corbière‐Divialle, H., Harms, K. & Rausch, T. (2009). Dissecting the regulation of fructan metabolism in chicory (Cichorium intybus) hairy roots. New Phytologist, 184(1), 127-140.
  7. Le Roy, K., Lammens, W., Verhaest, M., De Coninck, B., Rabijns, A., Van Laere, A. & Van den Ende, W. (2007). Unraveling the difference between invertases and fructan exohydrolases: A single amino acid (Asp-239) substitution transforms Arabidopsis cell wall invertase1 into a fructan 1-exohydrolase. Plant Physiology, 145(3), 616-625.
  8. Lothier, J., Lasseur, B., Prud’homme, M. P. & Morvan-Bertrand, A. (2010). Hexokinase-dependent sugar signaling represses fructan exohydrolase activity in Lolium perenne 1. Functional Plant Biology, 37(12), 1151-1160.
  9. Lu, C., Koroleva, O. A., Farrar, J. F., Gallagher, J., Pollock, C. J. & Tomos, A. D. (2002). Rubisco small subunit, chlorophylla/b-binding protein and sucrose: fructan-6-fructosyl transferase gene expression and sugar status in single barley leaf cells in situ. Cell type specificity and induction by light. Plant Physiology, 130(3), 1335-1348.
  10. Maicaurkaew, S., Jogloy, S., Hamaker, B. R. & Ningsanond, S. (2017). Fructan: fructan 1-fructosyltransferase and inulin hydrolase activities relating to inulin and soluble sugars in Jerusalem artichoke (Helianthus tuberosus Linn.) tubers during storage. Journal of Food Science and Technology, 54(3), 698-706.
  11. Narai‐Kanayama, A., Tokita, N. & Aso, K. (2007). Dependence of fructooligosaccharide content on activity of fructooligosaccharide‐metabolizing enzymes in yacon (Smallanthus sonchifolius) tuberous roots during storage. Journal of Food Science, 72(6), S381-S387.
  12. Peukert, M., Thiel, J., Peshev, D., Weschke, W., Van den Ende, W., Mock, H. P. & Matros, A. (2014). Spatio-temporal dynamics of fructan metabolism in developing barley grains. The Plant Cell, 26, 3728–3744.
  13. Pfaffl, M. W., Horgan, G. W. & Dempfle, L. (2002) Relative expression software tool (REST_) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Research, 30, 36–36.
  14. Raessler, M., Wissuwa, B., Breul, A., Unger, W. & Grimm, T. (2008). Determination of water-extractable nonstructural carbohydrates, including inulin, in grass samples with high-performance anion exchange chromatography and pulsed amperometric detection. Journal of Agricultural and Food Chemistry, 56(17), 7649-7654.
  15. Rehman, R. U., Israr, M., Srivastava, P. S., Bansal, K. C. & Abdin, M. Z. (2003). In vitro regeneration of witloof chicory (Cichorium intybus L.) from leaf explants and accumulation of esculin. In Vitro Cellular & Developmental Biology-Plant, 39(2), 142-146.
  16. Saengkanuk, A., Nuchadomrong, S., Jogloy, S., Patanothai, A. & Srijaranai, S. (2011). A simplified spectrophotometric method for the determination of inulin in Jerusalem artichoke (Helianthus tuberosus L.) tubers. European Food Research and Technology, 233(4), 609–616.
  17. Suárez-González, E. M., López, M. G., Délano-Frier, J. P. & Gómez-Leyva, J. F. (2014). Expression of the 1-SST and 1-FFT genes and consequent fructan accumulation in Agave tequilana and A. inaequidens is differentially induced by diverse (a) biotic-stress related elicitors. Journal of Plant Physiology, 171(3-4), 359-372.
  18. Trevisan, F., Chu, E. P., Gaspar, M. & Carvalho, M. A. M. (2014). In vitro culture and fructan production by Vernonia herbacea (Asteraceae). Acta Physiologiae Plantarum, 36(9), 2299-2307.
  19. Valluru, R., Lammens, W., Claupein, W. & Van den Ende, W. (2008). Freezing tolerance by vesicle-mediated fructan transport. Trends in Plant Science, 13(8), 409-414.
  20. Van Arkel, J., Vergauwen, R., Sévenier, R., Hakkert, J.C., van Laere, A., Bouwmeester, H.J., Koops, A.J. & van der Meer, I.M. (2012). Sink filling, inulin metabolizing enzymes and carbohydrate status in field grown chicory (Cichorium intybus L.). Journal of Plant Physiology, 169(15), 1520-1529.
  21. Van den Ende, W., Mintiens, A., Speleers, H., Onuoha, A. A. & Van Laere, A. (1996). The metabolism of fructans in roots of Cichorium intybus during growth, storage and forcing. New Phytologist, 132(4), 555-563.
  22. Van Laere, A. & Van den Ende, W. (2002). Inulin metabolism in dicots: chicory as a model system. Plant, Cell & Environment, 25(6), 803-813.
  23. Velayutham, P., Ranjithakumari, B. & Baskaran P. (2006). An efficient in vitro plant regeneration system for Cichorium intybus L.–an important medicinal plant. Journal of Agricultural Technology, 2, 287–298
  24. Wei, H., Bausewein, A., Steininger, H., Su, T., Zhao, H., Harms, K., Greiner, S. & Rausch, T. (2016). Linking expression of fructan active enzymes, cell wall invertases and sucrose transporters with fructan profiles in growing taproot of chicory (Cichorium intybus): Impact of hormonal and environmental cues. Frontiers in Plant Science7, 1-15.

Wilson, R. G., Smith, J. A. & Yonts, C. D. (2004). Chicory root yield and carbohydrate composition is influenced by cultivar selection, planting, and harvest date. Crop Science, 44(3), 748-752



[1] Fructooligosaccharides (FOS)