بررسی الگوی بیان ژن‌های مرتبط با مقاومت به بیماری پوسیدگی اسکلروتینیایی یقه ساقه در آفتابگردان دانه روغنی (.Helianthus annuus L)

نوع مقاله : مقاله پژوهشی

نویسندگان

1 دانش آموخته دکتری بیوتکنولوژی کشاورزی، گروه بیوتکنولوژی گیاهی دانشکده کشاورزی دانشگاه فردوسی مشهد،

2 استاد گروه اصلاح و بیوتکنولوژی گیاهی دانشکده کشاورزی دانشگاه ارومیه.

3 استاد گروه بیوتکنولوژی گیاهی دانشکده کشاورزی دانشگاه فردوسی مشهد.

4 دانشیار گروه بیوتکنولوژی گیاهی دانشکده کشاورزی دانشگاه فردوسی مشهد

5 دانش آموخته کارشناسی ارشد بیوتکنولوژی کشاورزی، گروه اصلاح و بیوتکنولوژی گیاهی دانشکده کشاورزی دانشگاه ارومیه.

چکیده

آفتابگردان (Helianthus annuus L.) گیاهی است از خانواده کلاهپرک‌سانان که بیشتر برای استحصال روغن خوراکی کشت می­شود. قارچ اسکلروتینیا (Sclerotinia sclerotiorum) یکی از بیمارگرهایی با پراکندگی وسیع در مزارع آفتابگردان است که در صورت فراهم بودن شرایط محیطی مناسب، باعث از بین رفتن کل محصول می‌شود. استفاده از ژنوتیپ های مقاوم به بیماری، یکی از اقتصادی‌ترین روش‌های کنترل آن است. در این مطالعه، بیان ژن‌های PDF1.2(ژن دفاعی)، HaZFHD (فاکتور رونویسی) و HaPP2C (موثر در مسیر انتقال پیام دفاعی) در ژنوتیپ های 8A*/LC1064C (جزئی مقاوم) و SDR19 (حساس) آفتابگردان، بعد از آلودگی با جدایه‌ی (A37) قارچ عامل بیماری، با تکنیک PCR در زمان واقعی مورد بررسی قرار گرفت.  نتایج حاصل از پژوهش نشان داد که پس از مایه‌زنی با قارچ، بیان این ژن‌ها در ژنوتیپ جزئی مقاوم (8A*/LC1064C)، زودتر از ژنوتیپ حساس (SDR19) افزایش یافته است. افزایش نرخ بیان ژ‌ن‌های مورد بررسی در لاین جزئی مقاوم، احتمالا حاکی از نقش موثر آن‌ها در مقاومت جزئی آفتابگردان به قارچ عامل بیماری پوسیدگی یقه ساقه است. نتایج این پژوهش می­تواند در برنامه­های به­نژادی آفتابگردان برای تولید ارقام مقاوم به بیماری اسکلروتینیا مفید واقع شود.

کلیدواژه‌ها

موضوعات


عنوان مقاله [English]

Expression pattern of genes associated with resistance to Sclerotinia basal stem rot disease in oil seed sunflower (Helianthus annuus L.)

نویسندگان [English]

  • Rashid Paknia 1
  • Reza Darvishzadeh 2
  • Farajollah Shahriari 3
  • Saeed Malekzadeh 4
  • Noushafarin Boroukanlou 5
1 Ph.D in Agricultural Biotechnology, Department of Plant Biotechnology, Faculty of Agriculture, Ferdowsi University of Mashhad,, Iran
2 Department of Plant Breeding and Biotechnology, Urmia University, Urmia.
3 Department of Plant Biotechnology, Ferdowsi University of Mashhad,, Iran
4 Department of Plant Biotechnology, Ferdowsi University of Mashhad,, Iran
5 Department of Plant Breeding and Biotechnology, Urmia University, Urmia.
چکیده [English]

Sunflower (Helianthus annuus L.) from Asteraceae family is one of the most important crops grown mainly for edible oil. Sclerotinia is one of the fungi pathogens widely distributed in sunflower farms leading to totally yield losses under the favorable environmental conditions for the pathogen. The use of resistant genotypes is potentially one of the economically useful methods for its control. In this study, the expression pattern of genes PDF1.2 (defence related gene), HaZFHD (transcription factor) and HaPP2C (effective in defence signal transduction) was investigated in sunflower susceptible (SDR19) and partially resistant (8A*/LC1064C) lines after inoculation with Sclerotinia fungal isolate A37 via Real Time PCR technique. Results revealed that the expression of studied genes has significantly increased in an earlier time in partially resistant (8A*/LC1064C) line compared to susceptible (SDR19) one. Increased expression level of studied genes proves their potential role in resistance of sunflower to Sclerotinia basal stem rot disease. The findings of this study can be useful in sunflower breeding programs for producing cultivars resistant to Sclerotinia stem rot disease.

کلیدواژه‌ها [English]

  • Necrotrophic fungi
  • PDF1.2
  • oil seed crops
  • partially resistant
  • Sclerotinia sclerotiorum

مقدمه


آفتابگردان با نام علمی (.Helianthus annuus L)، یکی از منابع مهم روغن نباتی خوراکی است و پیش‌بینی شده است که در مدت کوتاهی، به یک منبع کارآمد بیودیزل (سوخت زیستی) تبدیل شود (Sunflower Statistic, NSA, USA, 2007). خاستگاه این گیاه، آمریکای شمالی و یا بنا به نظر برخی محققین، منطقه‌ای بین مکزیک و پرو (Lentz et al., 2001; Smith, 2006; Heiser, 2008). گیاه آفتابگردان سازگاری خوبی به بسیاری از شرایط اقلیمی دارد و به همین دلیل، زراعت آن در بسیاری از مناطق جهان از جمله کشور ما رایج است و در طرح خودکفایی تولید روغن خوراکی می‌تواند نقش پراهمیتی داشته باشد. علاوه بر تنش‌های غیرزیستی، تنش‌های زیستی به‌ویژه بیماری‌های گیاهی، یکی از عمده‌ترین چالش‌های کشاورزی در سراسر جهان است. در اغلب نقاط جهان، مهم‌ترین بیماری­های آفتابگردان توسط قارچ­ها ایجاد می­شوند که از جمله آن‌ها می­توان به بیماری پوسیدگی اسکلروتینیایی یقه ساقه و طبق ایجاد شده توسط گونه­هایSclerotinia  اشاره کرد.

Sclerotinia sclerotiorum یکی از مهم­ترین بیمارگرهای نکروتروف گیاهی است (Bolton et al., 2006)؛ این قارچ به علت انتشار گسترده و دامنه میزبانی وسیع (بیش از 400 گونه گیاهی)، خسارت سنگینی به محصولات کشاورزی وارد می‌کند. این بیمارگر در تمامی مراحل رشد آفتابگردان، باعث پوسیدگی ریشه، ساقه، یقه و طبق می­شود و در مناطق کشت با آب و هوای خنک و مرطوب، باعث ایجاد خسارت سنگین به آفتابگردان می‌شود (Masirevic & Gulya, 1992). با توجه به موقعیت و شرایط اقلیمی، استان آذربایجان‌غربی از پتانسیل قابل توجهی در تولید آفتابگردان برخوردار است. در سال­های اخیر، شیوع و گسترش بیماری پوسیدگی اسکلروتینیایی در این استان، باعث کاهش سطح زیر کشت آفتابگردان شده است و در مزارعی که کشت انجام می‌شود، خسارت وارده به حدی می­رسد که محصول قابل قبولی برداشت نمی­شود (مشاهدات مزرعه ای نگارندگان).

مقاومت به بیمارگر نکروتروفیک S. sclerotiorum در گیاهان میزبان، در تعداد محدودی از گونه‌ها و ارقام زراعی پیدا شده است اما سازوکارهای مقاومت هنوز به‌طور کامل شناسایی نشده است. بعضی از گونه‌های وحشی آفتابگردان مانند Helianthus mollis, Helianthus nuttallii   و Helianthus maximiliani مقاومت متوسط تا زیادی به بیمارگر نکروتروفیک
S. sclerotiorum نشان داده‌اند (Skoric, 1993). تاکنون ژنوتیپی با مقاومت کامل به بیماری پوسیدگی اسکلروتینیایی در آفتابگردان زراعی شناسایی نشده است اما ژنوتیپ­ها، سطوح متفاوتی از مقاومت در برابر این بیماری را نشان می‌دهند (Hahn, 2002; Khalifani et al., 2018). ژنتیک مقاومت به پوسیدگی اسکلروتینیایی یقه ساقه در آفتابگردان، به صورت پلی‌ژنیک با اثرات کوچک هر یک از ژن‌ها در بروز مقاومت می‌باشد (Davar et al., 2010; Amouzadeh et al., 2013; Talukder et al., 2014). برای کنترل موفقیت‌آمیز بیماری، تلفیق روش‌های زراعی، شیمیایی و استفاده از ژن‌های مقاومت در میزبان پیشنهاد شده است (Emamgholi et al., 2015).

در سال‌های اخیر، مقاومت القایی به عنوان یک جایگزین بالقوه یا استراتژی مکمل برای حفاظت از محصولات زراعی ارائه شده است. مقاومت القایی شامل کنترل آفات و بیمارگر‌ها، به‌وسیله فعال کردن مسیرهای دفاعی در گیاهان است (Kogel & Langen, 2005). القای ژن‌های دفاعی در گیاهان در پاسخ به بیمارگرها، در مرتبه اول در سطح رونویسی رخ می‌دهد و در مرتبه دوم، تنظیم الگوهای بیان زمانی و مکانی ژن‌های دفاعی، مهم‌ترین قسمت از سیستم دفاعی گیاه به شمار می‌رود (Hao et al., 2009). بنابراین سرعت پاسخ گیاه به بیمارگر، از مهم‌ترین عوامل تعیین کننده مقاومت یا حساسیت گیاه مورد نظر به بیمارگر می‌باشد؛ به‌طوری که اگر پاسخ‌های دفاعی گیاه پس از حمله بیمارگر سریع تر اتفاق افتد، گیاه در مقابل این بیمارگر مقاومت نشان خواهد داد ولی اگر پاسخ‌های دفاعی با سرعت کم و به آهستگی، پس از آلودگی صورت گیرد ،گیاه به بیمارگر حساس است و قادر به مقاومت نخواهد بود. بنابراین به نظر می‌رسد که شناسایی به موقع حمله ریزسازواره ها و سرعت پاسخ‌های دفاعی القا شده می‌تواند تفاوت اصلی بین گیاهان حساس و مقاوم باشد (Hammond-Kosak & Parker, 2003). دستاوردهایی که در این حوزه به دست آمده است، در مورد گیاه مدل آرابیدوپسیس است  که به تدریج منجر به انتقال این نتایج به گیاهان زراعی شده است.

شناسایی اجزای انتقال پیام همچون عوامل رونویسی در راستای بیان ژن‌های دفاعی گیاه، این امید را به‌وجود آورده است که این عوامل، ابزار مناسبی جهت افزایش تحمل گیاهان در برابر طیف وسیعی از بیمارگرها باشند. این عوامل، از اجزای مهم و کلیدی در کنترل بیان ژن در همۀ بافت‌های زنده می‌باشند و باعث تنوع فنوتیپی و سازگاری موجودات در طی تکامل می‌شوند (Chew et al., 2013). عوامل رونویسی زیادی در گیاهان شناسایی شده است که بعضی از آن‌ها در پاسخ به تنش‌ها، اعم از تنش‌های زیستی مانند بیمارگرها و تنش‌های غیرزیستی مانند گرما، سرما و همچنین نور زیاد یا کم، نقش دارند. از میان عوامل رونویسی مختلف، پروتئین‌های AP2 Domain ،WEKY، MYBو HD-ZIP، بارزترین نقش را در پاسخ به تنش‌ها دارند (Javelle et al., 2011).

تولید فرم‌های فعال اکسیژن مانند پراکسید هیدروژن (H2O2)، سوپر اکسید و یون هیدروکسیل، از فرآیندهای اولیه پاسخ دفاعی گیاهان به حمله بیمارگرها می‌باشد (Hao et al., 2009). تولید ترکیبات ضد میکروبی، تقویت دیواره سلولی و ترشح پروتئین‌های مرتبط با بیماری‌زایی (Pathogenesis related protein, PRP) (Wei et al., 2004) و تخریب هسته، دیگر واکنش‌های دفاعی گیاهان می‌باشند (Ryerson & Heath, 1996). پروتئین‌های مرتبط با بیمارگر (PR)، گروه متنوعی از پروتئین‌های گیاهی هستند که در پاسخ به حمله بیمارگرها بیان می‌شوند .(Van Loon et al., 2006) این پروتئین‌ها موجب تخریب دیواره‌های سلولی قارچ، ایجاد اختلال در غشاهای سلولی آن، تقویت سیستم پاسخ دفاعی میزبان، دخالت در بیماری‌زایی و سنتز پروتئین‌های ضد قارچی می‌شوند (Dahleen et al., 2001). این پروتئین‌ها معمولاً در شرایط نرمال به مقدار کم در گیاهان بیان می شوند اما میزان‌شان در پاسخ به تنش یا حمله بیمارگرها، به میزان زیادی افزایش می‌یابد (Van Loon et al., 1999). دیفنسین‌ها و تیونین‌ها، گروه مهمی از پلی‌پپتید‌های ضد میکروبی هستند که به ترتیب به خانواده PR12 و PR13 تعلق دارند
(Van Loon et al., 2006). دیفنسین‌ها و پروتئین‌های کوچک (حدود 5 KDa)، ماهیت بازی دارند و غنی از سیستئین هستند. اولین دیفنسین‌ها از گندم و جو جداسازی شدند و در ابتدا، آن‌ها را به عنوان زیر گروهی از خانواده تیونین‌ها می‌دانستند. سپس این گروه از پروتئین‌ها دیفنسین نامیده شدند. بعضی از این پروتئین‌ها در غلظت‌های کم (میکرو مولار) و در شرایط  in vitro، فعالیت ضد قارچی در مقابل طیف وسیعی از قارچ‌های رشته‌ای نشان می‌دهند و از رشد طولی ریسه جلوگیری می‌کنند و باعث تغییر نفوذپذیری غشای سلول‌های قارچ می‌شوند (Portieles et al., 2010). فعالیت ضد قارچی این پلی‌پپتیدها در محیط کشت علیه بسیاری از قارچ‌ها ثابت شده است و این ژن‌ها در جریان مقاومت گیاه بیان می‌شوند. دیفنسین‌‌ها با تغییر در نفوذ پذیری غشای بیمارگر، منجر به توقف رشد آن می‌شوند.

با توسعه روش‌های زیست مولکولی، مطالعه خصوصیات ژن­های گوناگون درگیر در مقاومت به بیمارگرها و سازوکارهای دخیل در مقاومت آسان شده است. این تحقیقات، شناسایی ژن‌های مطلوب و همچنین نقش و اهمیت این ژن­ها در پاسخ به بیماری‌ها و تولید ارقام متحمل از طریق روش‌های زیست‌فناوری را هموارتر می‌سازند. این مطالعه با هدف بررسی بیان ژن‌های PDF1.2، HaZFHD و HaPP2C که در منابع مختلف (Veronese et al., 2004; Fusari et al., 2012)، دخالت آن‌ها در مقاومت به بیماری نشان داده شده است، در دو ژنوتیپ ‌8A*/LC1064C (جزئی مقاوم) و SDR19 (حساس) آفتابگردان دانه روغنی، بعد از آلودگی با جدایه‌ی A37 قارچ S. sclerotiorum و با تکنیک PCR در زمان واقعی انجام شد. نتایج حاصل از این پژوهش می‌تواند در تولید گیاهان مقاوم به عامل بیماری پوسیدگی اسکلروتینیایی یقه ساقه در آفتابگردان سودمند باشد.

 

مواد و روش‌ها

مواد گیاهی و آلودگی با جدایه قارچ عامل بیماری

دو ژنوتیپ (8A*/LC1064C و SDR19) با واکنش حساسیت متفاوت به جدایه A37، از مجموعه ژنوتیپ‌های مورد استفاده در تجزیه ارتباطی انتخاب شدند (Khalifani, 2016; Paknia, 2018). بذرهای هر دو ژنوتیپ در گلدان‌های مستطیلی شکل با ابعاد 20 × 60 سانتی‌متر در محیط پیت ماس کشت شدند. گیاهان در شرایط کنترل شده با دمای 1±25 درجه سانتی‌گراد، رطوبت نسبی 65% و با فتوپریود 12 ساعت تاریکی/روشنایی به مدت شش هفته تا مرحله V6-V8 پرورش یافتند (Schneiter & Miller, 1981). آزمایش‌ در قالب طرح پایه کاملا تصادفی، با سه تکرار و هر تکرار شامل شش گیاهچه انجام شد. جدایه قارچی در محیط کشت آگار دکستروز سیب زمینی (Potato Dextrose Agar, pH 6) در اتاق تاریک با دمای 1±25 درجه سانتی‌گراد کشت شد. وقتی‌ که گیاهان به مرحله هشت برگی رسیدند، گیاهان با جدایه‌ قارچ اسکلروتینیا (A37) از محل یقه آلوده شدند. برای تلقیح از دیسک‌های میسیلیوم به قطر سه میلی‌متر در بخش پایه­ای ساقه گیاهان استفاده شد. بعد از قرار دادن میسیلیوم در پای بوته، یک پنبه خیس روی آن قرار داده شد و به‌منظور حفظ رطوبت برای رشد قارچ، اطراف آن با پارافیلم بسته شد (شکل 1). در زمان­های صفر به‌ عنوان شاهد و سه، شش، 12، 24 و 48 ساعت بعد از آلودگی با جدایه­‌ قارچی، از محل آلوده نمونه برداری انجام شد و نمونه ها در نیتروژن مایع، به فریزری با دمای 80- درجه سانتی‌گراد منتقل شدند. به ‌منظور کنترل کارایی تلقیح، چندین گیاه تلقیح شده از ژنوتیپ­های A*/LC1064C و SDR19 تا چند روز بعد از تلقیح رشد داده شدند؛ در این مدت امکان مشاهده نکروز به‌ صورت واضح وجود داشت.

 

 

  

 

استخراج RNA و سنتز cDNA

استخراج RNA از نمونه‌های برگی، با استفاده از محلول استخراج RNX-plusTM (شرکت سیناکلون، ایران)، طبق دستورالعمل شرکت و بر روی یخ انجام گرفت. قبل از استخراج، همه وسایل دوبار استریل شدند و به مدت 20 دقیقه در زیر هود و در معرض تابش اشعه UV قرار گرفتند. برای بررسی کمیت و کیفیت RNA استخراج‌شده، از دستگاه اسپکتروفتومتری و ژل آگارز یک درصد استفاده شد. فرآیند جداسازی توسط الکتروفورز با ولتاژ 90 ولت و به مدت 45 دقیقه انجام شد و پس از عکس‌برداری، صحت RNA بررسی شد. برای سنتز cDNA، در تیوب استریل 2/0 میلی­لیتری، مقدار پنج میکرولیتر آب عاری از نوکلئاز ریخته شد. سپس شش میکرولیتر RNA استخراج شد و یک میکرولیتر آغازگر الیگو dT به آن اضافه شد. پس از انجام یک سانتریفیوژ پالسی، تیوب حاوی مواد به مدت پنج دقیقه در دمای °C65 قرار گرفت. پس از سرد کردن تیوب حاوی مواد روی یخ، یک ورتکس نرم انجام گرفت. سپس چهار میکرولیتر بافر واکنش x5، یک میکرولیتر آنزیم  RiboLockTM RNase Inhabitor (20 واحد در میکرولیتر)، دو میکرولیتر مخلوط dNTP (10 میلی­مولار) و یک میکرولیتر آنزیم (RevertAidTM M-MuLV Revers Transcriptase) (200 واحد در میکرولیتر) به تیوب حاوی مواد اضافه شد. پس از انجام سانتریفیوژ پالسی، تیوب حاوی مواد به مدت 60 دقیقه در دمای °C42 و به مدت پنج دقیقه در دمای °C72 قرار داده شد. برای ساخت cDNA از کیت Fermrntas LIFE SCIENCE #K1621  استفاده شد و پس از ساخت cDNA، واکنش‌های کنترل مثبت و منفی به منظـور بررسی صحت ساخت cDNA  و عدم وجود آلودگی‌هـای ژنـومی صورت گرفت و پس از تأیید cDNA  سـاخته شـده، میـزان بیـان سه ژن PDF1.2، HaZFHD و HaPP2C  بررسی شد. دو ژن‌ (HaZFHD و HaPP2C)،براساس نتایج مطالعات نقشه یابی ارتباطی برای مقاومت به بیماری پوسیدگی اسکلروتینیایی در آفتابگردان (Fusari et al., 2012) و تجزیه بیان آن‌ها در پاسخ به بیماری S. sclerotiorum در کلزا (Brassica napus) (Zhao et al., 2007) و ژن PDF1.2 به‌دلیل نقش آن در مکانسیم دفاعی آفتابگردان به تنش های زیستی (Şestacova et al., 2016) انتخاب شدند.  

 

جدول 1- مشخصات ژن ها و توالی آغازگرهای مورد استفاده در این تحقیق

Table 1. Characteristics of genes and sequence of primers used in the present study

Primer sequences (5'®3')

Target locus in Arabidopsis thaliana

Gene name

Putative functions

Annealing temperature

Length of fragment

Forward

GCTAACAGGGAAAAGATGACTC

AF282624.1

Actin

Reference Gene

58.5

96

Backward

ACTGGCATAAAGAGAAAGCACG

Forward

ACTGGGACTACGGCATTGAC

At1g48040

HaPP2C

Signal transduction pathway

60

398

Backward

TGCTGAATTTCTGGCTCTGA

Forward

AATGAGCTCTCATGGCTAAGTTTGCTTCC

AF364865.1

PDF1.2

Induction of the JA-dependent defence signalling pathway.

62

168

Backward

AATCCATGGAATACACACGATTTAGCACC

Forward

TCATGCCCTCACTAACATGC

At1g14687

HaZFHD

Transcription factor activity & protein binding

57

166

Backward

TTTGTCCGGAATCTTTTTCG

 


PCR در زمان واقعی

برای انجام PCR در زمان واقعی، از کیتMaxima SYBR Green/Fluorescein qPCR Master Mix (2x) #K0241 شرکت فرمنتاز استفاده شد و جهت نرمـال سـازی داده‌هـا از ژن Actin به عنوان ژن مرجع[1] یا خانه دار استفاده شد. سه تکرار بیولوژیک[2] برای هر تیمار در آزمایش در نظر گرفته شد. ترکیب و مقادیر مواد مورد نیاز جهت انجام PCR در زمان واقعی، در حجم 5/12 میکرولیتر در جدول (2) آورده شده است. پس از اتمام چرخه­های PCR، منحنی ذوب برای هر ژن به دست آمد و با استفاده از آن، درستی تکثیر محصول مربوط به هر ژن تأیید شد (شکل 2). پیک­های اضافی در منحنی ذوب، همیشه نشان­ دهنده اختصاصی عمل نکردن واکنش تکثیر نیست. اگرچه به طور معمول فرض می‌شود که یک رابطه تناتنگی بین تعداد قله ها و تعداد محصولات حاصل از تکثیر وجود دارد، اما در برخی موارد، نحوه توزیع بازهای گوانین- سیتوزین در طول توالی، باعث تولید دامنه های مختلف ذوب می شود (Kharabi Masooleh & Saidi, 2018).

 

 

جدول 2‑ ترکیب و مقادیر  مواد مورد نیاز جهت انجام PCR در زمان واقعی در بررسی بیان ژن‌های مورد مطالعه

Table 2. The composition and quantities of substances required for real time PCR in the expression of studied genes.

Amount (µl)

Material name

28.11

Maxima SYBR Green/ Fluorescein qPCR Master Mix (2X)

2

Forward primer (10 µM)

1

Reverse primer (10 μM)

0.5

cDNA (500 μg)

1

Water, nuclease-free

 

  

 

تجزیه‌ آماری داده‌های حاصل از بیان ژن‌

برای محاسبه میزان نسبی بیان ژن در نمونه تیمار نسبت به نمونه شاهد، از روش ΔΔCT به‌صورت زیر استفاده شد  (Pfaffl et al., 2004).

ΔCT (نمونه هدف) = CT - (ژن هدف)CT (ژن خانه دار در همان نمونه)

 ΔCT (نمونه شاهد) = CT - (ژن هدف)CT (ژن خانه دار در همان نمونه)

 ΔΔCT = ΔCT (نمونه هدف) - ΔCT (نمونه شاهد)

میزان بیان ژن در نمونه‌ تیمار شده نسبت به شاهد، از رابطه -∆∆ᴄᴛ2 محاسبه شد. تجزیه‌ داده‌های حاصل از میزان نسبی بیان ژن‌های مورد مطالعه، بر پایه طرح کاملاً تصادفی انجام گرفت. تجزیه‌ واریانس داده‌ها و مقایسه‌ میانگین تیمارها با استفاده از نرم‌افزار  SPSS 22 انجام گرفت و نمودارها با Excel رسم شدند.

نتایج و بحث

واکنش فنوتیپی ژنوتیپ های مختلف آفتابگردان دانه روغنی به جدایه قارچ عامل بیماری پوسیدگی اسکلروتینیایی یقه ساقه (S. sclerotiorum)، سه روز پس از آلودگی، به‌صورت درصد قسمت نکروزه و پوسیده در یک سانتی‌متری از پایه­ ساقه یادداشت شد و نتایج نشان داد که ژنوتیپ های مختلف، واکنش­ متفاوتی در مقابل عامل بیماری نشان دادند. بر اساس مطالعات فتوتیپی، ژنوتیپ 8A*/LC1064C به جدایه قارچ عامل بیماری (A37)، مقاوم جزئی داشت اما ژنوتیپ SDR19 حساس بود (Paknia, 2018; Khalifani, 2016) (جدول 3).

 

 

 

جدول 3- متوسط درصد نکروز در لاین‌های آفتابگردان روغنی آلوده شده با جدایه (A37) قارچ عامل بیماریSclerotinia sclerotiorum

Table 3. Mean percentage of necrosis of oily sunflower lines inoculated with S. sclerotiorum isolate (A37)

Genotype

Response to fungal

isolate (A37)

Origin

Type

Percentage of

contamination

(mean ± se)

SDR19

Susceptible

USA

Breeder line

0.00±100٪

8A*/LC1064C

Partially

Resistant

France

Breeder line

3.68±59.33٪

 

 

به‌منظور بررسی مقاومت ژنوتیپ ها به جدایه‌ قارچی عامل بیماری (A37) در سطح مولکولی، تغییرات بیان ژن های HaZFHD، PDF1.2 و HaPP2C با PCR در زمان واقعی بررسی شد. نتایج تجزیه واریانس نشان می­دهد که تاثیر ژنوتیپ، زمان پس از آلودگی و اثر متقابل ژنوتیپ × زمان بر روی میزان بیان ژن های PDF1.2 و HaPP2C در سطح احتمال یک درصد معنی‌دار بود. در رابطه با ژن HaZFHD، اثر ژنوتیپ روی بیان معنی‌دار نبود ولی اثر زمان پس از آلودگی و اثر متقابل ژنوتیپ × زمان بر روی میزان بیان ژن معنی‌دار است. معنی‌دار بودن اثر متقابل نشان می دهد که الگوی بیان ژن‌های مورد بررسی در ژنوتیپ ها (8A*/LC1064C و SDR19) پس از آلودگی با قارچ عامل بیماری پوسیدگی اسکلروتینیایی، بسته به زمان، متفاوت است (جدول 4).

 

جدول 4- تجزیه واریانس بیان ژن‌های مورد مطالعه در لاین‌های  8A*/LC1064C و SDR19 در پاسخ به جدایه (A37) قارچ عامل بیماری پوسیدگی اسکلروتینیایی یقه ساقه

Table 4. Variance analysis of genes expression in sunflower (Helianthus annuus L.) lines (SDR19 and 8A*/LC1064C) in response to A37 isolate of Sclerotinia sclerotiorum; fungal agent of basal stem rot disease.

Source of variations

degree of freedom

PDF1.2

HaZFHD

HaPP2C

Mean sqaure

P-value

Mean square

P-value

Mean sqaure

P-value

Genotype

1

116.75

0.00

58.62

0.42ns  

3756.25

0.00

Time

4

79.52

0.00

1064.48

0.00

2144.48

0.00

Genotype × Time

4

92.41

0.00

2281.28

0.00

1638.45

0.00

Error

18

6.64

-

95.42

-

41.79

-

ns، ** و *: به‌ترتیب غیرمعنی دار و معنی‌دار در سطح احتمال یک و پنج درصد.

ns, ** and *: Non-significant, significant at 1% and 5% of probability levels, respectively.

 

 

بیان ژن PDF1.2

الگوی بیان ژن PDF1.2 در ژنوتیپ جزئی مقاوم 8A*/LC1064C، سه ساعت بعد از آلودگی القاء شد و نسبت به ژنوتیپ حساس، به حداکثر میزان بیان خود رسید در حالی‌ که این افزایش بیان در لاین حساس SDR19، شش ساعت پس از آلودگی با قارچ عامل بیماری اسکلروتینیا اتفاق افتاد (شکل 3). بنابراین افزایش سطح تظاهر ژن PDF1.2 در ژنوتیپ حساس، با تاخیر و از نظر میزان در فاصله زمانی شش تا 24 ساعت بعد از آلودگی بود. احتمالا بیان زود هنگام این ژن در ژنوتیپ جزئی مقاوم، باعث جلوگیری از رشد بیمارگر می شود و به‌عنوان محرک سازوکارهای دفاعی و بیان ژن‌های مرتبط با آن می‌تواند در ایجاد مقاومت نقش موثری داشته باشد.

بر اساس مطالعات، PDF1.2 ژنی است که در مقاومت گیاهان به قارچ‌های نکروتروف نقش اساسی دارد (Veronese et al., 2004). دیفینسین گیاهی (PDF1.2)، اغلب به عنوان یک نشانگر رایج برای مسیر القای پیام دفاعی وابسته به جاسمونیک اسید می‌باشد. بررسی‌ها نشان داده است که فعالیت نسخه‌برداری ژن دفاعی دیفینسین تحت تنش‌های زیستی، بیشتر از ژن‌های NPR1[3] و PAL[4] تغییر می‌یابد (Grant & Lamb, 2004). ژن های NPR1 و PAL جزو ژن های دفاعی هستند. ژن NPR1 یک تنظیم کننده کلیدی مسیر مقاومت اکتسابی سیستمیک با واسطه  اسید سالسیلیک است. سطوح نسخه‌برداری ژن PDF1.2بر اساس مطالعات پیشین در ژنوتیپ‌های مقاوم افزایش داشته است ولی عدم بیان یا فعالیت تاخیری این ژن در ژنوتیپ‌های حساس مشاهده شده است (Radwan et al., 2005).

 

  

 

 

بررسی الگوی بیان ژن HaZFHD در دو ژنوتیپ 8A*/LC1064C و SDR19 طی زمان‌های مختلف پس از آلودگی نشان می‌دهد که بیان این ژن در زمان‌های اولیه (سه و شش ساعت) در ژنوتیپ جزئی مقاوم نسبت به حساس تا حدودی افزایش یافت و سپس افزایش بیان با تاخیر (12 ساعت) در ژنوتیپ حساس دیده شد. دوباره در 48 ساعت بعد از آلودگی، این ژن افزایش بیان در ژنوتیپ جزئی مقاوم نشان داد (شکل 4) که احتمالا به‌دلیل آلودگی ثانویه در گیاه میزبان، همزمان با انشعابات شبکه میسیلیومی قارچ بوده است. بنابراین می‌توان گفت که افزایش زودهنگام بیان این ژن نیز احتمالا با مقاومت به بیماری ارتباط داشته باشد. طبق نتایج، بیان ژن HaZFHD با توجه به ترکیب ژنوتیپ-زمان متفاوت است که نشان دهنده نقش این ژن در مکانیسم دفاعی گیاه در برابر تنش زیستی می‌باشد. ژن HaZFHD عمدتا در تنظیم رونویسی نقش دارد (https://www.arabidopsis.org/servlets/TairObjecttype=locus&name=At1g14687). ژن حاوی همودمین انگشت روی[5] به اندازه تقریبی60 آمینواسیدی است که در اتصال پروتئین به DNA نقش دارد. پروتئین‌های حاوی این دمین در تنظیم بیان ژن‌های مختلف از جمله ژن‌های دخیل در مکانیسم دفاع به بیمارگرها و انتقال پیام نقش اساسی دارند (http://www.ebi.ac.uk/interpro/entry/IPR006456).

 

بیان ژن HaPP2C

 بررسی الگوی بیان ژن HaPP2C در دو ژنوتیپ 8A8/LC1064C و SDR19 پس از آلودگی با قارچ عامل بیماری اسکلروتینیا نشان می‌دهد که سطح بیان این ژن در ژنوتیپ مقاوم در مقایسه با ژنوتیپ حساس در سه و شش ساعت پس از آلودگی با قارچ اسکلروتینیا، به‌طور معنی‌داری افزایش یافته است (شکل 5). افزایش بیان در ژنوتیپ جزئی مقاوم در مقایسه با ژنوتیپ حساس، دوباره در 48 ساعت بعد از آلودگی  مشاهده شد.  با توجه به  القاء  سریع  و  بیان بالای این ژن در ژنوتیپ جزئی مقاوم، می‌توان استنباط کرد که احتمالا این ژن در واکنش‌های مرتبط با مقاومت دخیل ‌باشد. 

 

 

 

 

 

سرعت پاسخ گیاه به بیمارگر، از مهم‌ترین عوامل تعیین کننده مقاومت یا حساسیت گیاه مورد نظر به بیمارگر می‌باشد، به‌طوری‌که اگر پاسخ‌های دفاعی گیاه به سرعت پس از حمله بیمارگر القاء شود، گیاه در مقابل بیمارگر مقاومت نشان می‌دهد ولی اگر پاسخ‌های دفاعی با سرعت کم و به آهستگی پس از آلودگی صورت گیرد، گیاه به بیمارگر حساس است و قادر به مقاومت نیست (Hammond-Kosack & Parker, 2003). بنابراین به نظر می‌رسد که شناسایی به موقع حمله میکروارگانیسم‌ها و سرعت پاسخ‌های دفاعی القاء شده می‌تواند تفاوت اصلی بین گیاهان حساس و مقاوم باشد. بررسی Zhao et al. (2007) نشان می دهد که ژن Protein phosphatase 2C (PP2C)-related (HaPP2C) در مسیر انتقال پیام دفاعی فعال می‌باشد. نتایج این تحقیق نشان داد که در زمان‌های اولیه پس از آلودگی، اکثرا بیان ژن‌های مورد بررسیدر ژنوتیپ جزئی مقاوم بیشتر از ژنوتیپ حساس بود. به عبارتی، سطح بیان این ژن‌ها در ژنوتیپ جزئی مقاوم در اثر آلودگی نسبت به ژنوتیپ حساس، سریع‌تر افزایش یافته است؛ بنابراین می‌توان نتیجه‌گیری کرد که احتمالا این ژن‌ها، نقش مهمی در کنترل بیان عوامل القاکننده مقاومت گیاه به بیماری اسکلروتینیا دارند. طبق این نتایج، مقاومت ژنوتیپ 8A8/LC1064C در سطح مولکولی تایید می‌شود و می‌توان از آن،  به عنوان لاین بالقوه مناسب برای ایجاد هیبرید مقاوم به بیماری اسکلروتینیا استفاده کرد. در پژوهشی، تغییرات بیان ژن­های کد کننده عوامل رونویسی (AP2 Domain، HD-Zip و MYB Family) در واکنش به جدایهSSU53  عامل بیماری اسکلروتینیا (Sclerotinia sclerotiorum) در ژنوتیپ­های حساس (RHA266) و جزئی مقاوم (LC106-C) آفتابگردان با تکنیک Real time PCR بررسی شد. نتایج نشان داد که میزان بیان ژن کد کننده عوامل رونویسی مورد مطالعه در لاین­های حساس و مقاوم آفتابگردان متفاوت است به‌طوری‌که میزان بیان ژن کد کننده عوامل رونویسی AP2 Domain و MYB Family در لاین مقاوم LC106-C در مقایسه با لاین حساس RHA265 به‌طور معنی­داری افزایش نشان داد. نتایج، نشان­دهنده نقش بالقوه مثبت عوامل رونویسی AP2 Domain وMYB Family در مکانیسم مقاومت گیاه آفتابگردان در پاسخ به آلودگی قارچ عامل اسکلروتینیا بود (Najafzadeh et al., 2017). در مطالعه دیگری،Darvishzadeh et al.  (2008) گزارش کردند که بیان دو عامل رونویسی AP2 domain و MYB-related در پاسخ به جدایه­های قارچ عامل بیماری ساقه سیاه[6] در ترکیبات مختلف ژنوتیپ-جدایه متفاوت است درحالی‌که تفاوتی در بیان عامل رونویسی HD-Zipمشاهده نشد. Zhang et al (2009) با انتقال ژن GmERF3 که یک عامل رونویسی از نوع AP2/EFR می­باشد، از گیاه سویا به توتون مشاهده نمودند که گیاه گیرنده، مقاومت قابل توجهی نسبت به بیمارهای ناشی از باکتری Ralstonia solanacearum و قارچ Alternata alternaria نشان می‌دهد. در بررسی الگوی بیان ژن­های فنیل آلانین آمونیالیاز دو (PAL2) و پروتئین شبه توماتین (TLP) در لاین­های آفتابگردان در پاسخ به جدایه­های قارچ عامل بیماری اسکلروتینیا گزارش شد که در رابطه با ژن PAL، بین دو لاین مورد بررسی در زمان­های شش و 48 ساعت پس از آلودگی و در رابطه با ژن TLP در 48 ساعت پس از آلودگی، اختلاف معنی­داری از نظر میزان بیان وجود دارد، به‌طوری‌که سطح بیان نسبی PAL در ژنوتیپ جزئی مقاوم در زمان شش ساعت پس از آلودگی، 166 برابر و در 48 ساعت پس از آلودگی، هشت برابر بیشتر از ژنوتیپ حساس بود. سطح بیان نسبی ژن TLP نیز در لاین مقاوم، 631 برابر بیشتر از لاین حساس بود (Nouri et al., 2017). در پژوهشی، Mohammadian-Farsani et al.  (2014) گزارش کردند که سطح رونوشت ژن­های فنیل­آلانین­آمونیا لیاز دو (PAL2) و پروتئین شبه توماتین (TLP) در ژنوتیپ­های آفتابگردان در پاسخ به جدایه­های قارچ عامل بیماری ساقه سیاه (Phoma macdonaldii)، تحت تأثیر جدایه، ژنوتیپ و اثر متقابل ژنوتیپ- جدایه می­باشد. بیان ژن‌های NPR1 و PDF1.2 در هیپوکوتیل آفتابگردان تحت شرایط آلودگی با سفیدک پودری[7] ارزیابی شد و نتایج نشان داد که ژن NPR1 با فعالیت بیان سریع، مرتبط با واکنش فوق حساسیت و راه‌اندازی سازوکار SAR در بافت گیاه مقاوم در مقایسه با شاهد بود و همچنین سطح نسخه ژن‌های PDF1.2 و PR5 در ژنوتیپ‌های مقاوم افزایش یافت. از طرفی عدم بیان یا فعالیت دیرهنگام این ژن‌ها در ترکیب حساس مشاهده شد (Radwan et al., 2005). در ارزیابی واکنش هفت لاین آفتابگردان به انگل گل جالیز طی آزمایشات مزرعه‌ای چندساله، ژنوتیپ ها به سه گروه مقاوم، متحمل و حساس تفکیک شدند. در ادامه بررسی بیان ژن‌های NPR1، PAL، دیفنسین و PR5 در لاین‌های آفتابگردان در طی آلودگی با سه جمعیت انگل گل جالیز با استفاده از RT-PCR نشان داد که بیان ژن PR5 و دیفنسین در گیاهان آلوده اختلاف معنی‌داری با گیاهان شاهد داشتند اما ژن‌های PAL و NPR1 تغییرات کمتری را بین گیاهان آلوده و شاهد نشان دادند (Şestacova et al., 2016). در تحقیقی، تجزیه QRT-PCR نشان داد که اختلاف کمی در بیان ژن‌های PDF1.2 و VSP2 بین موتانت‌های حساس (jin1) آرابیدوپسیس به بیماری S. sclerotiorum و نوع وحشی وجود دارد (Guo & Stotz, 2007). چندین هورمون گیاهی در تنظیم پاسخ دفاعی گیاه نقش مهمی ایفا می‌کنند. درحالی‌که اسید سالیسیلیک در تحریک ژن‌های درگیر در مقاومت به بیمارگر‌های بیوتروف نقش دارد، اسید جیبرلیک و اتیلن در واکنش به بیمارگر‌های نکروتروف نقش دارند (Mc Dowell & Dangl, 2000). در تحقیقی، تغییرات بیان فاکتورهای نسخه‌برداری در دو ژنوتیپ مقاوم (H. maximiliani) و حساس (H. annuus) آفتابگردان در پاسخ به آلودگی  با بیمارگر S. sclerotiorum مورد بررسی قرار گرفت. سطح فاکتورهای نسخه برداری مرتبط با مقاومت به بیمارگر مانند کومارات –کو ای- لیگاز و سیستئین پروتئاز در ژنوتیپ مقاوم افزایش یافت اما فاکتور نسخه برداری اس-آدنوزیل- میتیونین در ژنوتیپ حساس افزایش نشان داد (Muellenborn et al., 2011). در تحقیقی در پاتوسیستم کلزا- اسکلروتینیا مشخص شـد کـه سـطح بیان ژن های درگیر در تشخیص عامل بیماری‌زا، آبشار پیام دهـی پروتئین کیناز فعال شده با میتوژن (میتوژن: تحریک کننده تقسیم سلول و میتوز)، تنظیم کننـده نسـخه بـرداری از نوعWRKY ، تشـخیص پیـام دهـی اتـیلن و جاسـمونیک اسـید، بیوسنتز پروتئین های مرتبط با دفاع و ایندولیک گلوکوزینولات در لاین مقاوم بسیار بیشتر از لاین حساس است (Wu et al., 2016).

نتایج نشان داد که سطح بیان ژن‌های HaPP2C و HaZFHD در ژنوتیپ جزئی مقاوم  8A*/LC1064C در مقایسه با ژنوتیپ حساس SDR19 در زمان های اولیه بعد از آلودگی با قارچ عامل بیماری افزایش می یابد که احتمالا نشان دهنده مشارکت بالای این ژن‌ها در پاسخ‌های دفاعی در برابر آلودگی باشد. با تایید مقاومت لاین 8A*/LC1064C در مقابل عامل بیماری اسکلروتینیا در سطح مولکولی، می­توان از لاین مذکور به‌طور بالقوه در تولید ارقام هیبرید مقاوم در اصلاح نباتات متداول استفاده نمود و راه را برای کاهش خسارات ناشی از این بیماری در آفتابگردان هموار نمود.

 

 


REFERENCES

  1. Amouzadeh, M., Darvishzadeh, R., Haddadi, P., Aabdollahi Mandoulakani, B. & Rezaee Danesh, Y. (2013). Genetic analysis of partial resistance to basal stem rot (Sclerotinia sclerotiorum) in sunflower. Genetika, 45, 737-748.
  2. Bolton, M. D., Thomma, B. P. H. J. & Nelson, B. D. (2006). Sclerotinia sclerotiorum (Lib.) de Bary: biology and molecular traits of a cosmopolitan pathogen. Molecular Plant Pathology, 7, 1-16.
  3. Chew, W., Hrmova, M. & Lopato, S. (2013). Role of Homeodomain Leucine Zipper (HD-Zip) IV transcription factors in plant development and plant protection from deleterious environmental factors. International Journal of Molecular Sciences, 14, 8122-8147.
  4. Dahleen, L., Okubara, P. A. & Blech, A. E. (2001). Transgenic approaches to combat Fusarium head blight in wheat and barley. Crop Science, 41, 628-637.
  5. Darvishzadeh, R., Hewezi, T., Gentzbittel, L. & Sarrafi, A. (2008). Differential expression of defence-related genes between compatible and partially compatible sunflower–Phoma macdonaldii interactions. Crop Protection, 27, 740-746.
  6. Davar, R., Darvishzadeh, R, Majd, A., Gousta, Y. & Sarrafi, A. (2010). QTL mapping of partial resistance to basal stem rot in sunflower using recombinant inbred lines. Phytopatholgy Mediterranea, 49, 330-341.
  7. Emamgholi, A., Zaefizadeh, M. & Imani, A. (2015). The proteomic analysis of resistance to Sclerotinia sclerotiorum fungus in sunflower seedling stage. Trend in Life Science, 4, 2319-5037.
  8. Fusari C. M., Rienzo J. A. D., Troglia C., Nishinakamasu V., Moreno M. V., Maringolo C., Quiroz F., Álvarez D., Escande A., Hopp E., Heinz R., Lia V. V. & Paniego N. B. (2012). Association mapping in sunflower for Sclerotinia head rot resistance. BMC Plant Biology, 12(93), 1-13.
  9. Grant, M. & Lamb, C. (2006). Systemic immunity. Current Opinion in Plant Biology, 9, 414-420.
  10. Guo, X. & Stotz, H. U. (2007). Defense against Sclerotinia sclerotiorum in Arabidopsis is dependent on jasmonic acid, salicylic acid, and ethylene signaling. Molecular Plant-Microbe Interactions, 20(11), 1384-95.
  11. Hahn, V. (2002). Genetic variation for resistance to Sclerotinia head rot in sunflower inbred lines. Field Crop Research, 77, 153-159.
  12. Hammond-Kosack, K. E. & Parker, J. E. (2003). Deciphering plant-pathogen communication: Fresh perspectives for molecular resistance breeding. Current Opinion in Biotechnology, 14,177-193.
  13. Hao, J. J., Meng, Q. X., Yin, J. F. & Kirk, W. W. (2009). Characterization of a new Streptomyces strain, DS3024, that causes potato common scab. Plant Disease, 93, 1329-1334.
  14. Heiser, C. B. (2008). The sunflower (Helianthus annuus) in Mexico: Further evidence for a North American domestication. Genetic Resources and Crop Evolution, 55, 9-13.
  15. Javelle, M., Klein-Cosson, C., Vernoud, V., Boltz, V., Maher, C., Timmermans, M., Depege-Fargeix, N. & Rogowsky, P. (2011). Genome-wide characterization of the HD-ZIP IV transcription factor family in maize: preferential expression in the epidermis. Plant Physiology, 157, 790-803.
  16. Khalifani K. M. (2016). Studying the genotype– isolate interaction and association mapping in sunflower–Sclerotinia patosystem. MSc. Thesis, Faculty of Agriculture, Urmia University.
  17. Khalifani, K. M., Darvishzadeh, R. & Abrinbana, M. (2018). Aggressiveness diversity of Sclerotinia sclerotiorum and S. minor isolates in west Azarbaijan province and specific interaction of sunflower lines with the isolates of these pathogens. Applied Researches in Plant Protection, 7(1), 135-150. (In Persian)
  18. Kharabi Masooleh, A. & Saidi A. (2018). Application of uMeltSM algorithm in Real-time PCR melting curve analysis. Journal of Agricultural Biotechnology, 10(2): 43-58. (In Persian)
  19. Kogel, K. H. & Langen, G. (2005). Induced disease resistance and gene expression in cereals. Cellular Microbiology, 7, 1555-1564.
  20. Lentz, D. Pohl, M. Pope, K. & Wyatt, A. (2001). Prehistoric sunflower (Helianthus annuus L.) domestication in Mexico. Econ Botany, 55, 370-376.
  21. Masirevic, S. & Gulya, T. J. (1992). Sclerotinia and phomopsis—two devastating sunflower pathogens. Field Crops Research, 30, 271-300.
  22. Mc Dowell, J. M. & Dangl, J. L. (2000). Signal transduction in the plant immune response. Trends in Biochemistry Science, 25, 79-82.
  23. Mohammadian-Farsani, A., Hatami-Maleki, H., Darvishzadeh, R. & Hoshyardel, F. (2014). Study of changes in the Phenylalanine Ammonia-lyase 2 (PAL2) and thaumatin-like protein (TLP) genes transcripts in sunflower genotypes in response to fungal isolates associated with the black stem disease. Crop Biotechnology, 7, 15-23. (In Persian) 
  24. Muellenborn, C., Jens-Henning Krause, J. H. & Cerboncini, C. (2011). Analysis of differential transcript expression reveals time-dependent leaf responses to Sclerotinia sclerotiorum in wild and cultivated sunflower. Plant Molecular Biology Reporter, 29, 597-608.
  25. Najafzadeh, R., Darvishzadeh, R., Nouri, A. & Khalifani K. M. (2017). Gene expression profiling of transcription factors associated with resistance to Sclerotiniabasal stem rot disease in sunflower, Genetic Engineering and Bio-Safety Journal, 6(1), 131-142. (In Persian)
  26. Nouri, A., Darvishzadeh, R. & Abdollahi-Mandoulakani, B. (2017). Study of gene expression profiling of phenylalanine ammonialyase and thaumatin-like protein in sunflower infected by Sclerotinia stem rot disease. Genetic Engineering and Bio-Safety Journal, 6(1), 11-23. (In Persian)
  27. Paknia, R. (2018). Genetic analysis of resistance to Sclerotinia basal stem rot disease in oily sunflower (Helianthus annuus L.) using genomic and transcriptomic approaches. PhD Thesis, Faculty of Agriculture, Ferdowsi University of Mashhad.               
  28. Pfaffl, M. W., Tichopad, A., Prgomet, C. & Neuvians, T. P. (2004). Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper-Excel-based tool using pair-wise correlations. Biotechnology Letter, 26, 509-515.
  29. Portieles, R., Ayra, C., Gonzalez, E., Gallo, A., Rodriguez, R., Chacon, O., Lopez, Y., Rodriguez, M., Castillo, J., Pujol, M., Enriquez, G., Borroto, C., Trujillo, L., Thomma, B. P. & Hidalgo, O. B. (2010). NmDef02, a novel antimicrobial gene isolated from Nicotiana megalosiphon confers high-level pathogen resistance under greenhouse and field conditions. Plant Biotechnology Journal, 8, 678–690.
  30. Radwan, O., Mouzeyar, S., Venisse, J. S., Nicolas, P. & Bouzidi, M. F. (2005). Resistance of sunflower to the biotrophic oomycete Plasmopara halstedii is associated with a delayed hypersensitive response within the hypocotyls. Journal of Experimental Botany, 56, 2683-2693.
  31. Ryerson, D. E. & Heath, M. C. (1996). Cleavage of nuclear DNA into oligonucleosomal fragments during cell death induced by fungal infection or by abiotic treatments. Plant Cell, 8, 393–402.
  32. Schneiter, A. A. & Miller, J. F. (1981). Description of sunflower growth stages. Crop Science, 21, 901-903.
  33. Şestacova, T., Ion Giscă, I., Cucereavîi, A., Port, A. & Duca, M. (2016). Expression of defence-related genes in sunflower infected with broomrape. Biotechnology Biotechnological Equipment, 30(4), 685-691.
  34. Skoric, D. (1993). Wild species use in sunflower breeding—results and future directions. Plant Genetic Resource Letter, 93, 17–23.
  35. Smith, B. D. (2006). Eastern North America as an independent center of plant domestication. Proceedings of the National Academy of Sciences of the United States of America, 103, 12223-12228.
  36. Talukder, Z. I., Hulke, B. S., Marek, L. F. & Gulya, T. J. (2014). Sources of resistance to sunflower diseases in a global collection of domesticated USDA plant introductions. Crop Science, 54, 694-705.
  37. Van Loon, L. C. & Van Strien, E. A. (1999). The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiological and Molecular Plant Pathology, 55, 85-97.
  38. Van-Loon, L. C., Rep, M. & Pieterse, C. M. J. (2006). Significance of inducible defense-related proteins in infected plants. Phytopathology, 44, 135-162.
  39. Veronese, P., Chen, X., Bluhm, B., Salmeron, J., Dietrich, R. A. & Mengiste, T. (2004). The BOS loci of Arabidopsis are required for resistance to Botrytis cinerea infection. Plant Journal, 40, 558–574.
  40. Wei, Y. D., Shen, W. Y., Dauk, M., Wang, F., Selvaraj, G. & Zou, J. T. (2004). Targeted gene disruption of glycerol-3-phosphate dehydrogenase in Colletotrichum gloeosporioides reveals evidence that glycerol is a significant transferred nutrient from host plant to fungal pathogen. Journal of Biological Chemistry, 279, 429–435.
  41. Wu, J., Zhao, Q., Yang, Q., Liu, H., Li, Q., Yi, X., Cheng, Y., Guo, L., Fan, C. & Zhou, Y. (2016). Comparative transcriptomic analysis uncovers the complex genetic network for resistance to Sclerotinia sclerotiorum in Brassica napus. Scientific Reports, 6, 19007.
  42. Zhang, G., Chen, M., Li, L., Xu, Z., Chen, X., Guo, J. & Ma, Y. (2009). Overexpression of the soybean GmERF3 gene, an AP2/ERF type transcription factor for increased tolerances to salt, drought, and diseases in transgenic tobacco. Journal of Experimental Botany, 13, 3781-3796.
  43. Zhao, J., Wang, J., An, L., Doerge, R. W., Chen, Z. J., Grau, C. R., Meng, J. & Osborn, T. C. (2007). Analysis of gene expression profiles in response to Sclerotinia sclerotiorum in Brassica napus. Planta, 227, 13-24.


[1] . Internal control or reference gene or housekeeping gene

[2]. Biological repeats (=consist of different biological samples)

[3]. Natriuretic peptide receptor 1

[4]. Phenylalanine ammonia lyase

[5]. Zinc-finger-homeodomain (ZF- HD)

[6] .Phoma black stem

[7]. Downymildew

دوره 51، شماره 1
اردیبهشت 1399
صفحه 77-89
  • تاریخ دریافت: 28 مرداد 1397
  • تاریخ بازنگری: 14 دی 1397
  • تاریخ پذیرش: 23 بهمن 1397
  • تاریخ اولین انتشار: 01 اردیبهشت 1399